Inserts and ends

From Tol2Kit

Jump to: navigation, search

[edit] What are these sequences?

At the bottom of this page are insert sequences for all entry clones, and 5' and 3' end sequences for all destination clones, in the current version of the Tol2kit. In all cases, we have included sequence up through the appropriate "att shared" sequence--the core sequence that is shared between attL,R,B, and P sites.

These core sequences will overlap between adjacent components of an expression clone, and this overlap can be used to assemble a predicted contig for the expression clone. For instance, using the program Sequencher, just take the insert sequences for your 5', middle, and 3' clones, together with the 5' and 3' ends of your destination clone, and hit "Assemble Automatically" (be sure to set "minimum overlap" to 15 or less in Assembly Parameters).

[edit] Example: assembling sequence for an expression clone

As an example, here is what the predicted sequence for pDestTol2CG2;bactin:mCherry-IRES-EGFPpA would look like:

        <395.pDestTol2CG2 5' thru attR4 shared>
CCACCTAAATTGTAAGCGTTAAT...CAAGCTATCAACTTTGTATAGAAAAGTTG
                          CAACTTTGTATAGAAAAGTTGAAAATTCCAGTTTGAA...CAGCCTCAAGTTTGTACAAAAAAG
                                  <299.p5E_bactin2_insert>                  TTTGTACAAAAAAGCAGGCTCCACCATGGT...
                                                                                 <386.pME-mCherry_insert>
<386.pME-mCherry_insert>
...TAAGACCCAGCTTTCTTGTACAAAGT
                 CTTTCTTGTACAAAGTGGCCGCCCCT...AGGTTTTTTCCAACTTTATTATACA
                   <389.p3E-IRES-EGFPpA_insert>         CAACTTTATTATACATAGTTGATAATTC...CGCACATTTCCCCGAAAAGTG
                                                               <395.pDestTol2CG2 3' thru attR3 shared>

Image:expression clone.png

[edit] Insert and end sequences

Here are the sequences in FASTA format:

>222.p5E-hsp70_insert
CAACTTTGTATAGAAAAGTTGCTTCAGGGGTGTCGCTTGGTTATTTCCAA
AAATCAAATTAATTTTATTAAACTATTAGAACGAGCATGTTTTGTCTATA
TGCTACAGAAGATAAAAAATAATAGGAGTTAACAGTTATAAAACAACACA
CTTTGTTTCTATTGATTGTTGACCACACTGGGGTCTCATTAAGTTAGATT
AAAGACACACTAACTGGGTCAAAAGCAGCAGATTGATTTCATAGCACCAG
GGTAAACTTTCTAACACTTTTACGGCAATCATATACATTAAAATTAAATA
CAGACCACGACTGAACAAGGAGGATGATCTCCAATATTAAACAAAGAGAC
TTGTGCCTATTTCTCTGAGGGTAAACATGACCTCTCAAGTTAGCAAGTTG
GTTTTAACACTACAAAAATAGTTAAGACTGCAATCCCAGAATAAAGTATT
GGTTTTAACCAATCAATATAGTACAGTAAACATCCATTTGTTTTGTTGAA
ACGTTAAACAAATCTGACCAAAGCTATTAGCTTATATAAAACAGGTTTGC
CTTCTATGTAGCTGAAAACACCACAGGCCCGATTTTGCTACTGTGTAAAA
CATTTCAGCAAGATTTTTTTATTGCATTTTTTTTTACTGAATCGTTCAAA
CATTTTATCATTTTAGTTTGTTCATTCATTGCAACTGGAAAAACAACACA
TCACACAACCGCACATATTTCAGCAATAAGTACAATAAAACACTCAAATA
AAAAAAACATTTTAAATCTCTTTGTATTTTTGACCGCTGTTTCGCGTAAT
TTCACGGTAAAACTCTGGAAATCTCCACTACATTCCTCTCAGCGGCTCCT
CTCAATGACAGCTGAAGAAGTGACGCGGCTGCCTGCTGTGTTTTGATTGG
TCGAATTCACTGGAGGCTTCCAGAACAGTGTAGAGTCTGAACGGGTGCGC
GCTCTGCTGTATTTAAAGGGCGAAAGAGAGACCGCAGAGAAACTCAACCG
AAGAGAAGCGACTTGACAAAGAAGAAAAGAGCAGCCTGACAGGACTTTTT
CCCCGACGAGGTGTTTATTCGCTCTATTTAAGAATCTACTGTAAGGTAAG
TCTCAATATATTGTACTCTATTGGCTAATCAGAATTATATAGAGATTATA
TGTACTTAATGTCAAAAAATCAACTTTGTATATGTAATCTTTTTACATGT
GGACTGCCTATGTTCATCTTATTTTAGGTCTACTAGAAAATTATATTTCC
CGTTTTCACAATAAGGATTTTTAAAAAAAGCAATGAACAGACGGGCATTT
ACTTTATGTTGCTGACATTATTTTATATGAGCATAATAACCATAAATACT
AGCAAATGTCCTAAATGAATTTGTGTTAATGTTGTCTACAAAAGAAAATT
AGCGTTTTACTTGTACAACTAATAATAACTTGGTTATTAAGAGAATTTCA
CTTGTTGACTAGAAAAATCCTTTCATAATGAAACAATTGCACCATAAATT
GTATAAATATAAAATTAATTCTAATTGTTTTTTTTTCCTGCCAAGTTTGT
ACAAAAAAG
>228.p5E-MCS_insert
CAACTTTGTATAGAAAAGTTGGTAATACGACTCACTATAGGGCGAATTGG
GTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAA
TTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGT
GGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCAAGTTTGTACA
AAAAAG
>229.p3E_myc_pA_insert
CTTTCTTGTACAAAGTGGATCGATTTAAAGCTATGGAGCAAAAGCTCATT
TCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGA
CTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAA
TGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAG
CTCATTTCTGAAGAGGACTTGAATGAAATGGAGAGCTTGGGCGACCTCAC
CATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATTCAAGGCCTCTCG
AGCCTCTAGAACTATAGTGAGTCGTATTACGTAGATCCAGACATGATAAG
ATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAAT
GCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATA
AGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCA
GGTTCAGGGGGAGGTGTGGGAGGTTTTTTACAACTTTATTATACAAAGTT
G
>233.pME-nlsmCherry_insert
TTTGTACAAAAAAGCAGGCTACACCATGGCTCCAAAGAAGAAGCGTAAGG
TAATGGTGAGCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTC
ATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCGCGAGTTCGA
GATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCA
AGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTG
TCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGA
CATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGC
GCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCC
TCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAA
CTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGG
CCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATC
AAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTCAA
GACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACG
TCAACATCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTG
GAACAGTACGAGCGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGA
GCTGTACAAGTAAGACCCAGCTTTCTTGTACAAAGT
>234.pME-H2AmCherry_insert
TTTGTACAAAAAAGCAGGCTACACCATGGCAGGTGGAAAAGCAGGTAAAG
ACAGTGGCAAAGCCAAGGCGAAAGCAGTGTCTCGCTCGCAAAGAGCTGGT
CTTCAGTTTCCAGTGGGACGAATCCACAGGCACTTGAAGACACGCACTAC
AAGCCATGGTCGAGTAGGAGCAACAGCAGCCGTTTACAGCGCAGCCATTC
TTGAATATCTCACAGCTGAAGTTTTGGAGTTGGCGGGAAATGCTTCAAAA
GACCTGAAGGTGAAGCGCATCACTCCTCGACATTTACAGCTGGCCATTCG
AGGAGATGAGGAGCTCGATTCCCTTATCAAGGCCACTATTGCTGGAGGAG
GTGTGATTCCACACATCCACAAGTCTCTGATTGGTAAGAAGGGCCAGCAG
AAAACCGCAGGGGGGATGGTGAGCAAGGGCGAGGAGGACAACATGGCCAT
CATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACG
GCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGC
ACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGC
CTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGA
AGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGC
TTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGT
GACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGC
TGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACC
ATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCT
GAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACG
ACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCC
GGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCCACAACGAGGA
CTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGCCACTCCACCG
GCGGCATGGACGAGCTGTACAAGTAAGACCCAGCTTTCTTGTACAAAGT
>237.pME-MCS_insert
TTTGTACAAAAAAGCAGGCTTGTAAAACGACGGCCAGTGAGCGCGCGTAA
TACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGA
CGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTA
GTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTA
GTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCACCCAGCTT
TCTTGTACAAAGT
>299.p5E_bactin2_insert
CAACTTTGTATAGAAAAGTTGAAAATTCCAGTTTGAAGAAACTTTTCAAG
ACTCACCTTTTCACTGTTGGTCTTAATTTAGGTTGATTATTTTTGTCAAT
TTAATAATTACATTGTATTGTTCATATTTTATTGTCTTATTGTGGTGTTT
TTACAGCTTTTTTATTGTTCTGCTTTGTTACTGTTTGCCTTGTATGCATT
GTAGCGCTTTGGGTCTGAGAAAAGCGCACTATAAATAAACTGTATTATTA
TTATTAGGGATGGACATCACGGTGGCGCGATGGGTGGCACAATTACCTCA
CAGCAAGTAGGTTGCTGTTTAGAGCCCCGGCTGGATCAGTTGGCAGTTCT
GTGTGGAGTTTGCATGTTCTCCCTGTTCAAGTAGGTTTCCTCCCGGTGCT
CTGGTTTCCCCTCACAAGTCCAAAGACATGATGTATAGGTGAATGGGGTA
AGCTAAATTGACCATAGTGAGTGTGTGTGTGTGTGTGAATGAGAGTGTAT
AGGTGTTTCCCAGTGTTAGGTTGCAACTGGAAGGACATCTGCTGTGTAAA
ACATATGCAGGATAAGTTGGCGGTTCATTCCCCTATGGTGACCCCTGGTT
AATTAAAGGACTAAGTTGAAAATGAATGAATGAATGAATGATTAGAGATA
AACCGATACCACTTTTTTACAAACCGATATGAGTACAAGTATAATAGTTT
CTGTTACTCGACAATACTGAGTACCGATTCTGATACTTCTTGGATTTGGT
TTCAATGTAATTAATTTGAAAGAAGGTTTTATTTCTTGCCTGTCGCAAGG
ATGAACACAAAAATCTTTACCAGAAGGATATTTTAAGCTAAGAATATACG
CACGTTGTTGACAACCCTGTATCGATTACCGATTAAACGTGGACATTTAA
AGGATAAGTTATGCTTGCGCCATCACAACTTTACACATTACATGATCAAA
GATCATATTGAATATTCGGTTTATTCGTCAGAAGCCTATAGATTTGTTAA
AAGTGTATTTTATAAACGGATGGTTTATAAAGACTAAGCTATTAATATAT
CAGACATTCATTAATACATCAAGACATCGATGTCAGGTAGGACAACAAAT
CACATCCATGTAATGAAATCTTGTTGAGTGGTATTGGTGCGTGGTTTCAG
CATTTCATGTGCAATACGAGTAAGAATATTTTAACCAAGTATCGACCCAA
AACCTGATACTGGTATCGGTGCATCCCTTATTATTATTATTATCAAAAAC
ACACTTGTTTTATTTATGTGGGTGCCAAACAACAAACTATGAAATGCAGC
ATGACACGCCCAAAAAGTGTTCCTTTGAGAACAACTTCATAAATATGTTT
CTTATCATTATGCATGAATGGTGTACTGGGAGAGCTTTGGTATCAGAATT
GAGATAAGAGACTTTGGCATTCTAAAGGACAATGACATTATCACACTGAC
AGTCAACAACACTTTATTGCTCTGGAAATCTTATGTCATGGGGCAAAGCT
GAGGTTCATTAGGACAGTACCTTATTTAGAGATGAATGGGAAGGCTGTAG
TGGGCTGCTATCAGGGAAGGGTGGTGGTCCTCGGGGGAACTATGGACTCA
CAAAAGCACATCTGCTGTAACAAGATCCCCTGTGCAATCTACAAAAGTTA
CAAAGAGAAGCATGGTTGGTTAAAAAATAGAATTGACTGGATATGCTGAA
TGCATTGTTTGTTGTGTGTTACATCACATTAACCACAGATTGGTGCTAAA
TATTTGCTTATCTTATAAAAACCTGTGTGTTTATAAAGGGGGGTGTGGAT
GGATGCTTGGCATTCTTTGAAAAGATGTTGGGGGATGGAAGGAGGAGACC
TTATTGATGAGTATCCAGTTTGCAGATAACAAGTTTTTAGACATTCATAC
TATGATGCTGTTTATGTCTGTTTTTTCTCATTTTTTCTATACACAAACAG
CTATAAAACATTCACTTTTATATCTGATGCTGTATATTAAATTTCGTTGT
ATTTATTCTGTTTGCTCTGTTGGGTCATAGCTAGGGCCAGACAGAATCTG
CTGACATTTTTTGCTTTTTCTGCAGAGAATTTTGTAAACAATCTGTGATT
TATGCGAGATTTTTTCGGGAGTATCGTAACTAAAAACTTACTATATGAAA
TAAAAAAAAATAATACCTTTTTAACTTTTAATAAATATATACAATGCAAG
TCCACCTAGATCCAATTATTTGGTCGACAAAGCAAGTCTCTCACATAATA
TATCTTCTAAAAGACAGAAAACATTACTTTCAGACCATATTGTAATCAAA
TGAACACTTTCATATTAGTCAATAATATTACGGAAATGTATTTAAAAACT
GAATAAACATATATTTACACCTTTGTCTTTATTTCTAGAGTGCTTTTACA
ATGTAGATTGTGTCAAAGCAGCTTAACTTAGAGGATTAGTATAGTAAATT
GAAACTGTGTCAGTCCATTTTTTAAGAGTTTAAGTTCAGTTCAGTTTAGT
TCAGTGTGAGTTAATTTTTACTGCTGAGAGTCCAAACACTAAAGAGCAAA
TCCAAATACACAAGTCAATAAATAAACTCAATGATGGGCTAAAGATCTGG
GGAAATCTGCAGATTTCTGTGCGCACAGATTCTGTGTGGGCCTAGTCATT
ACCTATACTCAACGTTTACTCTGAGAAACTTCCATATTTTAGAGGTAAAA
TGCTCAGAATTGTAAAAAGTCTTGTCAAAATACTTGGAATTTGCCAAAAA
CAAAATAAAAGTCACATCACCTCATTGTCCTTGGTATCAGCAAGCACTTT
TAACACAATCAGCTGTTTTTGTTTATAACTCCCACTGAAGGCCATGTGCA
TTACTCCCAAGTTACACAGTAAAAAGTCACATGTAGTTTATCATGATCAC
TGCTGCTCAAGCACAGCTTTATCTGTTATTCAGTGTGGCAATATCTGAAA
TGTGTGCAAAATATTATTTATTGTAGCTGATCACCAACACTTTCAGTGTT
TTTTTTTTCTACTTTTAATGAGAATTATGTTCTTAGGATTTATCCTTATA
AACCTCTTTAAAAAGAAATGTTATGTCTGCATAGACACGACATGAAATTA
TGAACAGAAAATTTAACTATTTAAGATCAAGACTTGACATATAACATTTC
TAATGAACATTAAACCTGAGGTAGGCCCACTTGCAAAAATGTAACTGCTA
TCACTCACTTTATACATCATTGTGTAACTTGTACACACAAAAATAGTGAA
GCAATGTGGCATGGAATGCAGGTCCCATTCATTCAAAGTTATTAAAGCAC
TTTCTTAAAGTGCATTACTACTGAGCTAAGACCAGCTAGTTGCTCATACA
ACATACTACAAGTAGTGTCATCCTAATTTGGATAAAAAAAATGTCCATTT
TATACATGGAAAAGTACTCATTAGATCCCCCATTGTTTGTATTACGGTAT
TTCGTGAACACAAGAGGTAAATGACCTACAGAGCTGCTGTTGTGTTAGAT
TGAAAACACAACACAGGATCATGGAGGCATCCATCATTATGACGCATTCT
GCCACTTGTAACTCTGCACAGACTTTTTGAAAAGTTTAATTGAGTCTTGG
CGTTGTCGCAGAAAAATACGAAAAATTCTGTGTTAAAATTTGCAAATAAA
AATTCCAGTTTTATAGGAAATCGCCATGGCCTTGTTCTTTAACCAGTTAA
GCTTCCCCTTCTTTCACTCTCAAGTTGCAAGAAGCAAGTGTAGCAATGTG
CACGCGACAGCCGGGTGTGTGACGCTGGACCAATCAGAGCACAGAGCTCC
GAAAGTTTACCTTTTATGGCTAGAGCCGGGTATGTGCCGTCATATAAAAG
AGCGCGCCCAGCTTTTCAGCCTCACTTTGAGCTCCTCCACACGCAGCTAG
TGCGGAATATCATCTGCTTGTAACCCATTCTCTTAAGTCGACAACCCCCC
AAACCCAAGGTGAGTTGGTTTTACAGTTTTTAAGCGTTTAATTATAGTTT
CTATCTATTAATGTTAAGTAAAATGTGTAAATGGATAAATATGATTTGAT
GAAGTCTTTAGACAGTTCATAACGGTCTCTTTGTAGTTATCTACTAGGTT
TGATTTATAAGTGGTGGTTCTTTTGATAATCTATGTTACATTTAATAAAT
ATTGGCTGTATCTTAACTTTTTTGTAGCGTTAGTGGATGTGGCAGGTGAG
AATGTCGGTAATTTAACGTGACCAGTCGTAGGCACGACATTGAACATTGA
ATAGGCCGGTGTGAAATGGGTGTTAAGTCTTAATATAAAGTTGTGTTCTG
GCTAATCTCTCTTTAACAGCCATAAATGTGATTTTTAACTACAGTTTTGA
GGGTGCTGGTGAGCATGTTGCACACTTGATGGATAGCCGGCATGGGAAGT
TCTTTGTGCAGGCAGTGCTGCAGCAGGGTGTGACCTACTTTAGCTAGCCG
GCTAACCAGCTCTCATCTGATGTAACGTAAACCCCATCAATCTAACATCG
GCTCATTCGTGCTTTATAAGATCGAAGATCTTGTTATTAGTAACGGGTAT
TGGCATTTAGTTTTAACTTGGTTAATTTTCTTTTTGTTATGTGTTCTATT
TAAATGTAGCCTGCAGCCCCCTCTGTCTTTAATGAAGCTGAAGATTAACG
TTAACGTTAGTGAAGTGTTGTATCCGCTATGAAAGATTTGAATTTTAGAG
GTGTGGTCCACTTTAATAACGGCTGCGGAGTTCTCTGGCTGCACTTCAGC
CGCTGTGACTGTCGAAGCAGAGCCCATCAGTTTTTCAGGATCTCGGTGAT
TTTTGAGGCTAGACTATGAACTGAACCGACTGAGAGTGACCGTCCAGAAA
TGCTTTAGTGTGAAGTCTCCGCTCACGAGGAGTCCGTGGACTGACTGCAG
ATCTGTGACGCAGTAACACCCGGCGGCAGACACCCGTTGAAATGCGGTTG
TGTAATTGATCGCAGGCGAGGGTGGAAGAGGATGTGAAACTTCATTTGTG
TAAAATTTAGGGAGTGGTCCTGGTGTGATGAATGTCGAAATCTGTTCCTT
TTTACTGAGCCCTACGACTCTGGCTGAGTGCCACACCGCCGGCAGCCGCA
AAGCGGCTCAAACCATTGCCTTTTATGGTAATAATGAGAGAATGCAGAGG
GACTTCCTTTGTCTGGCATATCTGAGGCGCGCGCTGTCACTAGCGCCCAC
CAGCGGTCAGACTGTAGAATGCAGAGCAAAACAGGAAGTTGACTCCAGAT
GGTCACATGCTTGCTGAAACGCCTCTCCCTGGCAGCAGTGCAATTCTAAC
AGTTTCCCTTTCTTTTACAGTTCAGCCTCAAGTTTGTACAAAAAAG
>302.p3E-polyA_insert
CTTTCTTGTACAAAGTGGGGGATCCAGACATGATAAGATACATTGATGAG
TTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGA
AATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAAC
AAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAG
GTGTGGGAGGTTTTTTCCAACTTTATTATACA
>327.p5E_UAS_insert
CAACTTTGTATAGAAAAGTTGGTAATACGACTCACTATAGGGCGAATTGG
GTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTAGGCCTCCA
AGGCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTCCGGCAAGGT
CGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCA
AGGCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTCCGGCAAGGT
CGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCA
AGGCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTCCGGCAAGGG
TCGACTCTAGAGGGTATATAATGGATCCCATCGCGTCTCAGCCTCACTTT
GAGCTCCTCCACACGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGA
GCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGT
TAATTCAAGTTTGTACAAAAAAG
>366.p3E_EGFPpA_insert
CTTTCTTGTACAAAGTGGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTC
ACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCA
CAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGC
TGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCC
ACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCC
CGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCT
ACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACC
CGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCT
GAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGG
AGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAG
AACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAG
CGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCC
CCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGC
AAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGAC
CGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCGGTGGAA
GATCTGGGAATTCAAGGCCTCTCGAGCCTCTAGATTCTGCAGCCCTATAG
TGAGTCGTATTACGTAGATCCAGACATGATAAGATACATTGATGAGTTTG
GACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATT
TGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGT
TAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGT
GGGAGGTTTTTTCCAACTTTATTATACA
>380.p5E-H2AFX_insert
CAACTTTGTATAGAAAAGTTGGGAAAATAGTCTGCTGGGGTTCCCCACCC
ATACGACTCAATGCAATTCTCAGACTTTTGTCTTTCATTCCAAATAACCT
GAACTTATAATAAAGGCAAGGGTGTTCTAACCAAAATAATAGCTACAGGA
AAGCATTTTAGCAATTATACAGTGAATTGCAGGTCACGAGTCAATGGCTC
AGCGCTTTATAGTCATTTTGGAGCATAAAGCCTGAAAAATGTATGAGCAA
AATGTTGTGATGACAGCGAACAATCTGAAGTGAAGGTGCTGCTGCTGGGC
CTTCTGAGGTATTCGGAGCTTTATATTGTTGTTCATTTGATGTTTAATTT
ATTCTGAATAAATTATTTTTGAAAAACCATTCCTCCTTTCTTATTTCCCA
TTATTAATCAGCTAAAAGTGAATTTCTCTAAAATGCACACTGAATCACTT
TTATTGTCACATCACGACAAAGTGATTTAATTCATTGTGCATTCTAAAGA
AATCGCATACAAATCACATTTTAAAGACATTTACATTGAGTGAATTAAAT
CTATAAAATATTACGTCACAATAAGTGTACATGAGAGGGTTAAACAAATG
AAAAAATTGGTTTTGCGTCAAACTGTGTTAAAATTCAGAGGGAATATGTT
CAATTGGTTTGAACTTACCGCCGAAATGTGATTGAGGTAAAGAAAGACCA
ATACTAGCGCAGACGAACCAAGCGAATCAATCAGCTCTCGCATATTCAGA
AGCACTCTGATTGGTTCGTTACTTTGCGCTGTTTATGCACTGCAAGATCA
AGCCAATGGGGGATTACATCCGCTCTGGTTTCACCACCGACAACCAATCA
GGTCCGTACTTCCCTTCGCGCAACCAATCAAATGTGTGGGCGGGACTATG
CTTTGAACGTTCAACCAGTCTTTAAATACTGCAGCAGTTTCATTGCCAAT
GTACTGATTTCTTGCACACGCGAAGAGTTAGCCAAGTTTGTACAAAAAAG
>381.p5E-Fse-Asc_insert
CAACTTTGTATAGAAAAGTTGGGCCGGCCCTTCGGCGCGCCCAAGTTTGT
ACAAAAAAG
>382.p5E_CMV-SP6_insert
CAACTTTGTATAGAAAAGTTGAAGGCCTCTTCGCTATTACGCCAGTCGAC
CGCCAATTCAATATGGCGTATATGGACTCATGCCAATTCAATATGGTGGA
TCTGGACCTGTGCCAATTCAATATGGCGTATATGGACTCGTGCCAATTCA
ATATGGTGGATCTGGACCCCAGCCAATTCAATATGGCGGACTTGGCACCA
TGCCAATTCAATATGGCGGACCTGGCACTGTGCCAACTGGGGAGGGGTCT
ACTTGGCACGGTGCCAAGTTTGAGGAGGGGTCTTGGCCCTGTGCCAAGTC
CGCCATATTGAATTGGCATGGTGCCAATAATGGCGGCCATATTGGCTATA
TGCCAGGATCAATATATAGGCAATATCCAATATGGCCCTATGCCAATATG
GCTATTGGCCAGGTTCAATACTATGTATTGGCCCTATGCCATATAGTATT
CCATATATGGGTTTTCCTATTGACGTAGATAGCCCCTCCCAATGGGCGGT
CCCATATACCATATATGGGGCTTCCTAATACCGCCCATAGCCACTCCCCC
ATTGACGTCAATGGTCTCTATATATGGTCTTTCCTATTGACGTCATATGG
GCGGTCCTATTGACGTATATGGCGCCTCCCCCATTGACGTCAATTACGGT
AAATGGCCCGCCTGGCTCAATGCCCATTGACGTCAATAGGACCACCCACC
ATTGACGTCAATGGGATGGCTCATTGCCCATTCATATCCGTTCTCACGCC
CCCTATTGACGTCAATGACGGTAAATGGCCCACTTGGCAGTACATCAATA
TCTATTAATAGTAACTTGGCAAGTACATTACTATTGGAAGTACGCCAGGG
TACATTGGCAGTACTCCCATTGACGTCAATGGCGGTAAATGGCCCGCGAT
GGCTGCCAAGTACATCCCCATTGACGTCAATGGGGAGGGGCAATGACGCA
AATGGGCGTTCCATTGACGTAAATGGGCGGTAGGCGTGCCTAATGGGAGG
TCTATATAAGCAATGCTCGTTTAGGGAACCGCCATTCTGCCTGGGGACGT
CGGAGCAAGCTTGATTTAGGTGACACTATAGACAAGTTTGTACAAAAAAG
>383.pME-EGFP_insert
TTTGTACAAAAAAGCAGGCTGGACCATGGTGAGCAAGGGCGAGGAGCTGT
TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGC
CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAA
GCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGC
CCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTAC
CCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG
CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA
CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG
CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT
GGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGA
AGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGC
AGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGG
CCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGA
GCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTG
ACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCGGTGG
AAGATCTGGGAATTCAAGGCCTCTCGAGCCTCTAGATTCTGCAGCCCTAT
AGCACCCAGCTTTCTTGTACAAAGT
>384.pME_EGFPCAAX_insert
TTTGTACAAAAAAGCAGGCTGGACCATGGTGAGCAAGGGCGAGGAGCTGT
TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGC
CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAA
GCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGC
CCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTAC
CCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG
CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA
CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG
CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT
GGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGA
AGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGC
AGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGG
CCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGA
GCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTG
ACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGAGGAGG
AAGATCTAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCT
GCAAGTGTGTGCTCTCCTGAGACCCAGCTTTCTTGTACAAAGT
>385.pME-nlsEGFP_insert
TTTGTACAAAAAAGCAGGCTGGACCATGGCTCCAAAGAAGAAGCGTAAGG
TAAATCGATCGAATTCAAGGCCTCTCGAGCCTCTAGAAGGTGGCGGAATG
GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGA
GCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCG
AGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACC
GGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGG
CGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCT
TCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTC
AAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGA
CACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG
GCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTC
TATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGAT
CCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGC
AGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC
CTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCA
CATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGG
ACGAGCTGTACAAGTAACACCCAGCTTTCTTGTACAAAGT
>386.pME-mCherry_insert
TTTGTACAAAAAAGCAGGCTCCACCATGGTGAGCAAGGGCGAGGAGGACA
ACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGC
TCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCC
CTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAG
GCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTT
CCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCG
TGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTAC
AAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCA
GAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGG
ACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGC
GGCCACTACGACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT
GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCC
ACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGC
CACTCCACCGGCGGCATGGACGAGCTGTACAAGTAAGACCCAGCTTTCTT
GTACAAAGT
>387.pME_Gal4VP16_insert
TTTGTACAAAAAAGCAGGCTGGACCATGAAGCTACTGTCTTCTATCGAAC
AAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAA
CCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCC
CAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAAT
CAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAA
GACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATT
GTTAACAGGATTATTTGTACAAGATAATGTGAATAAAGATGCCGTCACAG
ATAGATTGGCTTCAGTGGAGACTGATATGCCTCTAACATTGAGACAGCAT
AGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGTCAAAG
ACAGTTGACTGTATCTTCGAGGTCGACCCCGGGAATTCAGATCTCTCGAG
CCGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGC
GAGGACGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGA
CATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACT
CCGCCCCCTACGGCGCTCTGGATATGTAGCACCCAGCTTTCTTGTACAAA
GT
>388.p3E-mCherrypA_insert
CTTTCTTGTACAAAGTGGTTATGGTGAGCAAGGGCGAGGACGACAACATG
GCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGT
GAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACG
AGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCC
TTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTA
CGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCG
AGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTG
ACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGT
GAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGA
AGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGC
GCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCA
CTACGACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGC
TGCCCGGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCCACAAC
GAGGACTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGCCACTC
CACCGGCGGCATGGACGAGCTGTACAAGTAAGGCGCGCCTCTAGAACTAT
AGTGAGTCGTATTACGTAGATCCAGACATGATAAGATACATTGATGAGTT
TGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAA
TTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAA
GTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGT
GTGGGAGGTTTTTTCCAACTTTATTATACA
>389.p3E-IRES-EGFPpA_insert
CTTTCTTGTACAAAGTGGCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTA
CTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTA
TTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGG
CCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAG
GAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCT
TCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCC
CCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATA
CACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTT
GTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAA
GGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGT
ACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCC
CCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGG
CCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC
ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTC
CGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCA
TCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACC
CTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA
GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCA
CCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAG
TTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTT
CAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACA
GCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTG
AACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGA
CCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG
ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG
AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCAC
TCTCGGCATGGACGAGCTGTACAAGGGCGGTGGAAGATCTGGGAATTCAA
GGCCTCTCGAGCCTCTAGATTCTGCAGCCCTATAGTGAGTCGTATTACGT
AGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTA
GAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCT
TTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTG
CATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTCCA
ACTTTATTATACA
>390.p3E-IRES-EGFPCAAXpA_insert
CTTTCTTGTACAAAGTGGCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTA
CTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTA
TTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGG
CCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAG
GAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCT
TCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCC
CCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATA
CACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTT
GTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAA
GGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGT
ACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCC
CCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGG
CCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCC
ATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTC
CGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCA
TCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACC
CTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA
GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCA
CCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAG
TTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTT
CAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACA
GCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTG
AACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGA
CCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG
ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG
AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCAC
TCTCGGCATGGACGAGCTGTACAAGGGAGGAGGAAGATCTAAGCTGAACC
CTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCC
TGATCTAGAACTATAGTGAGTCGTATTACGTAGATCCAGACATGATAAGA
TACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATG
CTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAA
GCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAG
GTTCAGGGGGAGGTGTGGGAGGTTTTTTCCAACTTTATTATACA
>391.p3E-IRESnlsEGFPpA_insert
CTTTCTTGTACAAAGTGGCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTA
CTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTA
TTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGG
CCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAG
GAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCT
TCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCC
CCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATA
CACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTT
GTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAA
GGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGT
ACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCC
CCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGG
CCACAACCATGGCTCCAAAGAAGAAGCGTAAGGTAAATCGATCGAATTCA
AGGCCTCTCGAGCCTCTAGAAGGTGGCGGAATGGTGAGCAAGGGCGAGGA
GCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAA
ACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTAC
GGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCC
CTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC
GCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCC
GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA
CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA
TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC
AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAA
GCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGG
ACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGC
GACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGC
CCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGT
TCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
CTGCAGCCCTATAGTGAGTCGTATTACGTAGATCCAGACATGATAAGATA
CATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCT
TTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGC
TGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGT
TCAGGGGGAGGTGTGGGAGGTTTTTTCCAACTTTATTATACA
>392.pDestTol2pA_3'_thru_attR3_shared
CACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAA
TACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT
CAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGC
CCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAG
AAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTG
GGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCG
CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTG
GCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGC
ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAA
GCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGA
CCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG
CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGC
GTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA
ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGAT
GGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTG
GCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGT
ATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT
CTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCG
CTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTT
TACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAG
GATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAAC
GTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGA
TCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAA
AAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAA
CTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
GTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGC
ACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA
GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCG
GATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAG
CTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTAT
GAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAA
CGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCC
AGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA
CATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCG
CCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGC
GAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCT
CCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCG
ACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACT
CATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTG
TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG
ATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAG
CTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCTGCTGGGCTTGC
TGAAGGTAGGGGGTCAAGAACCAGAGGTGTAAAGTACTTGAGTAATTTTA
CTTGATTACTGTACTTAAGTATTATTTTTGGGGATTTTTACTTTACTTGA
GTACAATTAAAAATCAATACTTTTACTTTTACTTAATTACATTTTTTTAG
AAAAAAAAGTACTTTTTACTCCTTACAATTTTATTTACAGTCAAAAAGTA
CTTATTTTTTGGAGATCACTTCATTCTATTTTCCCTTGCTATTACCAAAC
CAATTGAATTGCGCTGATGCCCAGTTTAATTTAAATGTTATTTATTCTGC
CTATGAAAATCGTTTTCACATTATATGAAATTGGTCAGACATGTTCATTG
GTCCTTTGGAAGTGACGTCATGTCACATCTATTACCACAATGCACAGCAC
CTTGACCTGGAAATTAGGGAAATTATAACAGTCAATCAGTGGAAGAAAAT
GGAGGAAGTATGTGATTCATCAGCAGCTGCGAGCAGCACAGTCCAAAATC
AGCCACAGGATCAAGAGCACCCGTGGCCGTATCTTCGCAGATCTGATCTA
GAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAA
AAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATT
GTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAA
TAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTT
GTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCATCATC
GATGGTACCGTAAAACGACGGCCAGTGAATTATCAACTATGTATAATAAA
GTTG
>392.pDestTol2pA_5'_thru_attR4_shared
CAACTTTTCTATACAAAGTTGATAGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGCTCGAGGGCCCATCTGGCCTGTGTTTCAGACACCAGGGAGTCT
CTGCTCACGTTTCCTGCTATTTGCAGCCTCTCTATCAAGACTAATACACC
TCTTCCCGCATCGGCTGCCTGTGAGAGGCTTTTCAGCACTGCAGGATTGC
TTTTCAGCCCCAAAAGAGCTAGGCTTGACACTAACAATTTTGAGAATCAG
CTTCTACTGAAGTTAAATCTGAGGTTTTACAACTTTGAGTAGCGTGTACT
GGCATTAGATTGTCTGTCTTATAGTTTGATAATTAAATACAAACAGTTCT
AAAGCAGGATAAAACCTTGTATGCATTTCATTTAATGTTTTTTGAGATTA
AAAGCTTAAACAAGAATCTCTAGTTTTCTTTCTTGCTTTTACTTTTACTT
CCTTAATACTCAAGTACAATTTTAATGGAGTACTTTTTTACTTTTACTCA
AGTAAGATTCTAGCCAGATACTTTTACTTTTAATTGAGTAAAATTTTCCC
TAAGTACTTGTACTTTCACTTGAGTAAAATTTTTGAGTACTTTTTACACC
TCTGTCAAGAACTCCTGGACAAACCTCTGACCTGTGTGGAACAGAGTGGA
TATGGGTGTCTGAACAGATATTCACGTCTTTTGCAGATCAGAGGGCATTT
CTGGTGTTGTGCAATGACCTGGGTCCAACAGGTAGGCGTACTCGTATCCA
AGAGCCTTGTTGGACAGGAGGTAGTCTCCATTCCTATAAAGAGGAAGGAA
TGGCACCATGTAGTAGCCGTCATTGTGGCCAATTGGTGCATTGGTACGTG
GGTAGATGGACCGGGGAGGCTGATGAGTTCTTAGCCAGCGCTCAAAGATG
CTAGAAATGATGTAAGAAACAAATATGCAAGATGAAAGTTAAGATAAGAT
AAAAAATTAAACAAATAAATGCAATTATGTTTTGTGTTTCTATTCCACCA
ATAATAACCTCACGCAGTAAAGCCACCAGATTATTTTTTGTTCTTTGCTC
TGCAGGGCAACCAAACTCTAACAATTGATCTCAATTGATCTTTCGCTGCT
CATCCAAGTACATTCACAAACTTCACTAATTGTAGCAGCTATAAACAACA
GATTGTATGAACTTTGTCAAAAACTGTGCAGTCTAATGTCATGACGTGTT
TGTTACCTGTCAATGAAAGCATGGTGAAGGAGGAAGATGGGGTCGTTGGC
TGAGCCCTGGACTGAGGACATTGAGCCGTTCATGAAGACATGCAGCGCAT
TGTGCATGGTGCTCTGGCCTTGCACAGCCATGCCTGTTTCTGGGCTGGCA
AAACCTACAAAGAAAAGAAGCAGGTGAAGAAGTTACAGTTTCAATCAAGA
TAACAGCAAAACAAGGCTAATTAAAAGACAGCAAAAAAAGGAGATGTAAA
ATATAGCTATTGATTTTCTTTACTTTTCTTTACGTAGGCAAATGTGACTT
AAGTGTGTTGTTGTATCCCCCCCCCCCCAGTTTTTTATGTATGCATTTAA
TCATTTCTGTAATGAATCTGTGGAAATTATTTCTTATTTTGACTACCAAT
CAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCA
ATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAAT
CTACCAACCAACCAACCAACCAACCAACCAACGACTGTATATGAGAACTG
TAATGAGTGACCTCCTCCTTCTAGTGATCCAAACAGGAAGAAGCTCCAAA
TGGCATGAATGCTCCAGTGGTGGCATTCATATTAAAATCTTTATTTAACA
TGTACTTGTTAATCATAATTTCTGTAATAACTTTTCTTTTCTGTAGCCCA
AGTTGTTGATATTATAAACTGACCAACCAGATGCCTTAATAAAAGTATGT
GCTCTCACATCCAACGTTCAAAACGTTTGACAGATTTTGTGCAGCCCGCT
TTCAAGTGGTAGGCTGTGGACTTCCAACAAGCTTACTTCTGATTGGTTAG
AGGGGTTGCCATAGGAACGGTGACTCAGACTCGACGCATCTCGGCTCTTT
CTTGCTTATTGGCGACGTCTAGCTCCAACACGGCGATGTCCATACAGTGA
AAAATGGCAACTGAATTAACTTCATTTTGTTGGAGCCAGAAGTAAGTCAT
TTTGAATGGGTGACGTAACACTCACTCGGTCCAGTTCTCAAATACAGTCA
ACAAGTACTATTACATAATAATAGTGTGTACTACTATTACATATTATTGT
AATAATGTCTGTTAAACACAGTCATAATTGAAAAAAAACAACTAAAACAT
TTATTCAAGGGTAAAGACAAATGCAGACAAATACAGAAAAGATTTAAAAT
AGCAGTAGAAAATGGCAAACGGGCTTATTCATCCAAGTTTTCAGCACTTG
TACAGGTGGGTAATTCCTACTATTTGGTACCCAATTCGCCCTATAGTGAG
TCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG
TTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAG
CGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCG
CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTC
GCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCG
ATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATG
GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACG
TTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAAC
ACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGA
TTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG
AATTTTAACAAAATATTAACGCTTACAATTTAGGTGG
>393.pDestTol2CG,_3'_thru_attR3_shared
CACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAA
TACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT
CAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGC
CCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAG
AAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTG
GGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCG
CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTG
GCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGC
ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAA
GCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGA
CCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG
CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGC
GTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA
ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGAT
GGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTG
GCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGT
ATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT
CTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCG
CTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTT
TACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAG
GATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAAC
GTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGA
TCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAA
AAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAA
CTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
GTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGC
ACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA
GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCG
GATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAG
CTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTAT
GAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAA
CGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCC
AGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA
CATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCG
CCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGC
GAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCT
CCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCG
ACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACT
CATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTG
TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG
ATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAG
CTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCTGCTGGGCTTGC
TGAAGGTAGGGGGTCAAGAACCAGAGGTGTAAAGTACTTGAGTAATTTTA
CTTGATTACTGTACTTAAGTATTATTTTTGGGGATTTTTACTTTACTTGA
GTACAATTAAAAATCAATACTTTTACTTTTACTTAATTACATTTTTTTAG
AAAAAAAAGTACTTTTTACTCCTTACAATTTTATTTACAGTCAAAAAGTA
CTTATTTTTTGGAGATCACTTCATTCTATTTTCCCTTGCTATTACCAAAC
CAATTGAATTGCGCTGATGCCCAGTTTAATTTAAATGTTATTTATTCTGC
CTATGAAAATCGTTTTCACATTATATGAAATTGGTCAGACATGTTCATTG
GTCCTTTGGAAGTGACGTCATGTCACATCTATTACCACAATGCACAGCAC
CTTGACCTGGAAATTAGGGAAATTATAACAGTCAATCAGTGGAAGAAAAT
GGAGGAAGTATGTGATTCATCAGCAGCTGCGAGCAGCACAGTCCAAAATC
AGCCACAGGATCAAGAGCACCCGTGGCCGTATCTTCGCAGATCTAAAGCT
TAAATCAGTTGTGTTAAATAAGAGACATTCAAAATAAATGTAAATGAGCT
CTCCAAATCAGCAGACTTAACATTCTTTAAAATGATTGATTCAATAGTGA
TAAAAATCAGGCATAGCCAGTTGTAACTTTAGATAAATTACAGAAAATGT
CAAATACAGAGAACCGATTCTTTTTTATGATACATCCAAGCACACATTTA
ACACAATCCAGGCAAACCCCGAATTTCACAGTCACAAGCACTGTTTGTAC
AAGAGCTTTGCCTAAGGACACACAGTCTCTATAAGTCCAGGTCGTTGGTT
TCACTCTTATTTTAAACATGTGACATTTTTCCTGCCATCCTGTCTTAGGC
TGCTGTTTGCTTCATTCCATGTCACATTAAATTCCTCAGTAGCACCTTTT
ACACACACAGCCAATCTTTTCCAGAAAATTCAATTGCTTTGAAGAGATAA
TGTGTGAACAAATCCATTTAGAAAAGGAAAATTAAGAATTTGTAAAATCA
TCTGTAAATTGTTGGCATTCTTCTGTATATGAACATCACATCATTTACAG
GTAAAGGTCTGGTCATTAATTATATGACAATTTACTGGTATTATTTTGTG
AAAGGGGCTATTTTCAATGCGTTCATCCATCCTTTTCATCCCTCAAATCT
CTCATTCACGTCCCCCTCCCCATCTGCACACTTTATCTCATTTTCCACCC
TGCTGGAATCTGAGCACTTGTGCAGTTATCAGGGCTCCTGTATTTAGGAG
GCTCTGGGTGTCCATGTAGGGGACGAACAGAAACACTGCAGACCTTTATA
GAAGAACAATTGATAAGAGTCCTCATACATAAAGACTCCATTAGTAAGCC
AGTGACCCAGGAGCCCAGACCAACAGCAAAGCAGACAGTGACCATGGTGA
GCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG
GACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGG
CGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA
AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTG
CAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAA
GTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGG
ACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACC
CTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAA
CATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATA
TCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGC
CACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAA
CACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGA
GCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATG
GTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGA
GCTGTACAAGTAAAGCGGCCCCTCTCGAGCCTCTAGAACTATAGTGAGTC
GTATTACGTAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAA
CCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGAT
GCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGAGATCTG
ATCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGC
TTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATG
CAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAA
AGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTC
TAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCA
TCATCGATGGTACCGTAAAACGACGGCCAGTGAATTATCAACTATGTATA
ATAAAGTTG
>393.pDestTol2CG,_5'_thru_attR4_shared
CAACTTTTCTATACAAAGTTGATAGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGCTCGAGGGCCCATCTGGCCTGTGTTTCAGACACCAGGGAGTCT
CTGCTCACGTTTCCTGCTATTTGCAGCCTCTCTATCAAGACTAATACACC
TCTTCCCGCATCGGCTGCCTGTGAGAGGCTTTTCAGCACTGCAGGATTGC
TTTTCAGCCCCAAAAGAGCTAGGCTTGACACTAACAATTTTGAGAATCAG
CTTCTACTGAAGTTAAATCTGAGGTTTTACAACTTTGAGTAGCGTGTACT
GGCATTAGATTGTCTGTCTTATAGTTTGATAATTAAATACAAACAGTTCT
AAAGCAGGATAAAACCTTGTATGCATTTCATTTAATGTTTTTTGAGATTA
AAAGCTTAAACAAGAATCTCTAGTTTTCTTTCTTGCTTTTACTTTTACTT
CCTTAATACTCAAGTACAATTTTAATGGAGTACTTTTTTACTTTTACTCA
AGTAAGATTCTAGCCAGATACTTTTACTTTTAATTGAGTAAAATTTTCCC
TAAGTACTTGTACTTTCACTTGAGTAAAATTTTTGAGTACTTTTTACACC
TCTGTCAAGAACTCCTGGACAAACCTCTGACCTGTGTGGAACAGAGTGGA
TATGGGTGTCTGAACAGATATTCACGTCTTTTGCAGATCAGAGGGCATTT
CTGGTGTTGTGCAATGACCTGGGTCCAACAGGTAGGCGTACTCGTATCCA
AGAGCCTTGTTGGACAGGAGGTAGTCTCCATTCCTATAAAGAGGAAGGAA
TGGCACCATGTAGTAGCCGTCATTGTGGCCAATTGGTGCATTGGTACGTG
GGTAGATGGACCGGGGAGGCTGATGAGTTCTTAGCCAGCGCTCAAAGATG
CTAGAAATGATGTAAGAAACAAATATGCAAGATGAAAGTTAAGATAAGAT
AAAAAATTAAACAAATAAATGCAATTATGTTTTGTGTTTCTATTCCACCA
ATAATAACCTCACGCAGTAAAGCCACCAGATTATTTTTTGTTCTTTGCTC
TGCAGGGCAACCAAACTCTAACAATTGATCTCAATTGATCTTTCGCTGCT
CATCCAAGTACATTCACAAACTTCACTAATTGTAGCAGCTATAAACAACA
GATTGTATGAACTTTGTCAAAAACTGTGCAGTCTAATGTCATGACGTGTT
TGTTACCTGTCAATGAAAGCATGGTGAAGGAGGAAGATGGGGTCGTTGGC
TGAGCCCTGGACTGAGGACATTGAGCCGTTCATGAAGACATGCAGCGCAT
TGTGCATGGTGCTCTGGCCTTGCACAGCCATGCCTGTTTCTGGGCTGGCA
AAACCTACAAAGAAAAGAAGCAGGTGAAGAAGTTACAGTTTCAATCAAGA
TAACAGCAAAACAAGGCTAATTAAAAGACAGCAAAAAAAGGAGATGTAAA
ATATAGCTATTGATTTTCTTTACTTTTCTTTACGTAGGCAAATGTGACTT
AAGTGTGTTGTTGTATCCCCCCCCCCCCAGTTTTTTATGTATGCATTTAA
TCATTTCTGTAATGAATCTGTGGAAATTATTTCTTATTTTGACTACCAAT
CAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCA
ATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAAT
CTACCAACCAACCAACCAACCAACCAACCAACGACTGTATATGAGAACTG
TAATGAGTGACCTCCTCCTTCTAGTGATCCAAACAGGAAGAAGCTCCAAA
TGGCATGAATGCTCCAGTGGTGGCATTCATATTAAAATCTTTATTTAACA
TGTACTTGTTAATCATAATTTCTGTAATAACTTTTCTTTTCTGTAGCCCA
AGTTGTTGATATTATAAACTGACCAACCAGATGCCTTAATAAAAGTATGT
GCTCTCACATCCAACGTTCAAAACGTTTGACAGATTTTGTGCAGCCCGCT
TTCAAGTGGTAGGCTGTGGACTTCCAACAAGCTTACTTCTGATTGGTTAG
AGGGGTTGCCATAGGAACGGTGACTCAGACTCGACGCATCTCGGCTCTTT
CTTGCTTATTGGCGACGTCTAGCTCCAACACGGCGATGTCCATACAGTGA
AAAATGGCAACTGAATTAACTTCATTTTGTTGGAGCCAGAAGTAAGTCAT
TTTGAATGGGTGACGTAACACTCACTCGGTCCAGTTCTCAAATACAGTCA
ACAAGTACTATTACATAATAATAGTGTGTACTACTATTACATATTATTGT
AATAATGTCTGTTAAACACAGTCATAATTGAAAAAAAACAACTAAAACAT
TTATTCAAGGGTAAAGACAAATGCAGACAAATACAGAAAAGATTTAAAAT
AGCAGTAGAAAATGGCAAACGGGCTTATTCATCCAAGTTTTCAGCACTTG
TACAGGTGGGTAATTCCTACTATTTGGTACCCAATTCGCCCTATAGTGAG
TCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG
TTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAG
CGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCG
CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTC
GCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCG
ATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATG
GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACG
TTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAAC
ACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGA
TTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG
AATTTTAACAAAATATTAACGCTTACAATTTAGGTGG
>394.pDestTol2pA2_3'_thru_attR3_shared
CACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAA
TACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT
CAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGC
CCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAG
AAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTG
GGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCG
CCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTG
GCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGC
ATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAA
GCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGA
CCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCG
CCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGC
GTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTA
ACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGAT
GGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTG
GCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGT
ATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT
CTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCG
CTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTT
TACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAG
GATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAAC
GTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGA
TCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAA
AAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAA
CTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
GTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGC
ACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA
GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCG
GATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAG
CTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTAT
GAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAA
CGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCC
AGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA
CATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCG
CCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGC
GAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCT
CCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCG
ACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACT
CATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTG
TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG
ATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAG
CTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCTGCTGGGCTTGC
TGAAGGTAGGGGGTCAAGAACCAGAGGTGTAAAGTACTTGAGTAATTTTA
CTTGATTACTGTACTTAAGTATTATTTTTGGGGATTTTTACTTTACTTGA
GTACAATTAAAAATCAATACTTTTACTTTTACTTAATTACATTTTTTTAG
AAAAAAAAGTACTTTTTACTCCTTACAATTTTATTTACAGTCAAAAAGTA
CTTATTTTTTGGAGATCACTTCATTCTATTTTCCCTTGCTATTACCAAAC
CAATTGAATTGCGCTGATGCCCAGTTTAATTTAAATGTTATTTATTCTGC
CTATGAAAATCGTTTTCACATTATATGAAATTGGTCAGACATGTTCATTG
GTCCTTTGGAAGTGACGTCATGTCACATCTATTACCACAATGCACAGCAC
CTTGACCTGGAAATTAGGGAAATTATAACAGTCAATCAGTGGAAGAAAAT
GGAGGAAGTATGTGATTCATCAGCAGCTGCGAGCAGCACAGTCCAAAATC
AGCCACAGGATCAAGAGCACCCGTGGCCGTATCTTCGCAGATCTGATCTA
GAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAA
AAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATT
GTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAA
TAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTT
GTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCATCATC
GATGGTACCGTAAAACGACGGCCAGTGAATTATCAACTATGTATAATAAA
GTTG
>394.pDestTol2pA2_5'_thru_attR4_shared
CAACTTTTCTATACAAAGTTGATAGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGCTCGAGGGCCCATCTGGCCTGTGTTTCAGACACCAGGGAGTCT
CTGCTCACGTTTCCTGCTATTTGCAGCCTCTCTATCAAGACTAATACACC
TCTTCCCGCATCGGCTGCCTGTGAGAGGCTTTTCAGCACTGCAGGATTGC
TTTTCAGCCCCAAAAGAGCTAGGCTTGACACTAACAATTTTGAGAATCAG
CTTCTACTGAAGTTAAATCTGAGGTTTTACAACTTTGAGTAGCGTGTACT
GGCATTAGATTGTCTGTCTTATAGTTTGATAATTAAATACAAACAGTTCT
AAAGCAGGATAAAACCTTGTATGCATTTCATTTAATGTTTTTTGAGATTA
AAAGCTTAAACAAGAATCTCTAGTTTTCTTTCTTGCTTTTACTTTTACTT
CCTTAATACTCAAGTACAATTTTAATGGAGTACTTTTTTACTTTTACTCA
AGTAAGATTCTAGCCAGATACTTTTACTTTTAATTGAGTAAAATTTTCCC
TAAGTACTTGTACTTTCACTTGAGTAAAATTTTTGAGTACTTTTTACACC
TCTGTCAAGAACTCCTGGACAAACCTCTGACCTGTGTGGAACAGAGTGGA
TATGGGTGTCTGAACAGATATTCACGTCTTTTGCAGATCAGAGGGCATTT
CTGGTGTTGTGCAATGACCTGGGTCCAACAGGTAGGCGTACTCGTATCCA
AGAGCCTTGTTGGACAGGAGGTAGTCTCCATTCCTATAAAGAGGAAGGAA
TGGCACCATGTAGTAGCCGTCATTGTGGCCAATTGGTGCATTGGTACGTG
GGTAGATGGACCGGGGAGGCTGATGAGTTCTTAGCCAGCGTGGGCCATCG
CCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAA
TAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCT
ATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAA
AATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAAC
GCTTACAATTTAGGTGG
>395.pDestTol2CG2_3'_thru_attR3_shared
CAACTTTATTATACATAGTTGATAATTCACTGGCCGTCGTTTTACGGTAC
CATCGATGATGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAA
CCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGAT
GCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAA
CAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGG
TTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGAT
CCTCTAGATCAGATCTCTTGTTTATTGCAGCTTATAATGGTTACAAATAA
AGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTC
TAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCT
ACGTAATACGACTCACTATAGTTCTAGAGGCTCGAGAGGGGCCGCTTTAC
TTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTC
CAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGG
ACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCG
ATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTC
GATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGT
CGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGC
CCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCG
GTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGT
TGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGC
ATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCT
GAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCA
CGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAG
GTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTAC
GTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCT
CGCCCTTGCTCACCATGGTCACTGTCTGCTTTGCTGTTGGTCTGGGCTCC
TGGGTCACTGGCTTACTAATGGAGTCTTTATGTATGAGGACTCTTATCAA
TTGTTCTTCTATAAAGGTCTGCAGTGTTTCTGTTCGTCCCCTACATGGAC
ACCCAGAGCCTCCTAAATACAGGAGCCCTGATAACTGCACAAGTGCTCAG
ATTCCAGCAGGGTGGAAAATGAGATAAAGTGTGCAGATGGGGAGGGGGAC
GTGAATGAGAGATTTGAGGGATGAAAAGGATGGATGAACGCATTGAAAAT
AGCCCCTTTCACAAAATAATACCAGTAAATTGTCATATAATTAATGACCA
GACCTTTACCTGTAAATGATGTGATGTTCATATACAGAAGAATGCCAACA
ATTTACAGATGATTTTACAAATTCTTAATTTTCCTTTTCTAAATGGATTT
GTTCACACATTATCTCTTCAAAGCAATTGAATTTTCTGGAAAAGATTGGC
TGTGTGTGTAAAAGGTGCTACTGAGGAATTTAATGTGACATGGAATGAAG
CAAACAGCAGCCTAAGACAGGATGGCAGGAAAAATGTCACATGTTTAAAA
TAAGAGTGAAACCAACGACCTGGACTTATAGAGACTGTGTGTCCTTAGGC
AAAGCTCTTGTACAAACAGTGCTTGTGACTGTGAAATTCGGGGTTTGCCT
GGATTGTGTTAAATGTGTGCTTGGATGTATCATAAAAAAGAATCGGTTCT
CTGTATTTGACATTTTCTGTAATTTATCTAAAGTTACAACTGGCTATGCC
TGATTTTTATCACTATTGAATCAATCATTTTAAAGAATGTTAAGTCTGCT
GATTTGGAGAGCTCATTTACATTTATTTTGAATGTCTCTTATTTAACACA
ACTGATTTAAGCTTTAGATCTGCGAAGATACGGCCACGGGTGCTCTTGAT
CCTGTGGCTGATTTTGGACTGTGCTGCTCGCAGCTGCTGATGAATCACAT
ACTTCCTCCATTTTCTTCCACTGATTGACTGTTATAATTTCCCTAATTTC
CAGGTCAAGGTGCTGTGCATTGTGGTAATAGATGTGACATGACGTCACTT
CCAAAGGACCAATGAACATGTCTGACCAATTTCATATAATGTGAAAACGA
TTTTCATAGGCAGAATAAATAACATTTAAATTAAACTGGGCATCAGCGCA
ATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCA
AAAAATAAGTACTTTTTGACTGTAAATAAAATTGTAAGGAGTAAAAAGTA
CTTTTTTTTCTAAAAAAATGTAATTAAGTAAAAGTAAAAGTATTGATTTT
TAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACA
GTAATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGTTCTTGACCCC
CTACCTTCAGCAAGCCCAGCAGATCCACTAGTTCTAGAGCGGCCGCCACC
GCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCT
TGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTC
ACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG
TGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCG
CTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAA
CGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCT
CACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC
ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGA
AAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGC
CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA
AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGA
TACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGAC
CCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGG
CGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTT
CGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTG
CGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT
TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTAT
GTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACAC
TAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCG
GAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGC
GGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATC
TCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG
AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTC
ACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT
ATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCAC
CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC
GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGC
TGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAA
TAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTA
TCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAG
TTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCG
TGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAA
CGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAG
CTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT
CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCC
GTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGA
ATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATA
ATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGT
TCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTC
GATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCA
CCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAG
GGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCA
ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATAT
TTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCC
CGAAAAGTG
>395.pDestTol2CG2_5'_thru_attR4_shared
CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTT
TGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCC
TTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTT
GGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGA
AAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATC
AAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAG
GGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGGCTGGCTAAGAACT
CATCAGCCTCCCCGGTCCATCTACCCACGTACCAATGCACCAATTGGCCA
CAATGACGGCTACTACATGGTGCCATTCCTTCCTCTTTATAGGAATGGAG
ACTACCTCCTGTCCAACAAGGCTCTTGGATACGAGTACGCCTACCTGTTG
GACCCAGGTCATTGCACAACACCAGAAATGCCCTCTGATCTGCAAAAGAC
GTGAATATCTGTTCAGACACCCATATCCACTCTGTTCCACACAGGTCAGA
GGTTTGTCCAGGAGTTCTTGACAGAGGTGTAAAAAGTACTCAAAAATTTT
ACTCAAGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGT
AAAAGTATCTGGCTAGAATCTTACTTGAGTAAAAGTAAAAAAGTACTCCA
TTAAAATTGTACTTGAGTATTAAGGAAGTAAAAGTAAAAGCAAGAAAGAA
AACTAGAGATTCTTGTTTAAGCTTTTAATCTCAAAAAACATTAAATGAAA
TGCATACAAGGTTTTATCCTGCTTTAGAACTGTTTGTATTTAATTATCAA
ACTATAAGACAGACAATCTAATGCCAGTACACGCTACTCAAAGTTGTAAA
ACCTCAGATTTAACTTCAGTAGAAGCTGATTCTCAAAATTGTTAGTGTCA
AGCCTAGCTCTTTTGGGGCTGAAAAGCAATCCTGCAGTGCTGAAAAGCCT
CTCACAGGCAGCCGATGCGGGAAGAGGTGTATTAGTCTTGATAGAGAGGC
TGCAAATAGCAGGAAACGTGAGCAGAGACTCCCTGGTGTCTGAAACACAG
GCCAGATGGGCCCTCGAGCAGGAAACAGCTATGACCATGATTACGCCAAG
CTATCAACTTTGTATAGAAAAGTTG
>450.pME-mCherryCAAX_insert
TTTGTACAAAAAAGCAGGCTCCACCATGGTGAGCAAGGGCGAGGAGGACA
ACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGC
TCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCC
CTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAG
GCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTT
CCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCG
TGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTAC
AAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCA
GAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGG
ACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGC
GGCCACTACGACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT
GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCC
ACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGC
CACTCCACCGGCGGCATGGACGAGCTGTACAAGAAGCTGAACCCTCCTGA
TGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTGAGACC
CAGCTTTCTTGTACAAAGT
>455.pME-EGFP-no_stop_insert
TTTGTACAAAAAAGCAGGCTGGACCATGGTGAGCAAGGGCGAGGAGCTGT
TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGC
CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAA
GCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGC
CCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTAC
CCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG
CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA
CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG
CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCT
GGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGA
AGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGC
AGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGG
CCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGA
GCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTG
ACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCGGTGG
AAGATCTGGGAATTCAAGGCCTCTCGAGCCTCTAGATTCTGCAGCCCTAC
ACCCAGCTTTCTTGTACAAAGT
>456.pME-mCherry_no_stop_insert
TTTGTACAAAAAAGCAGGCTCCACCATGGTGAGCAAGGGCGAGGAGGACA
ACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGC
TCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCC
CTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCC
TGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAG
GCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTT
CCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCG
TGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTAC
AAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCA
GAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGG
ACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGC
GGCCACTACGACGCCGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT
GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGCTGGACATCACCTCCC
ACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCGCCGAGGGCCGC
CACTCCACCGGCGGCATGGACGAGCTGTACAAGCACCCAGCTTTCTTGTA
CAAAGT
Personal tools