From Tol2Kit
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 23:00, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 22:59, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name)
- 22:59, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name) (current)
- 22:59, 2 November 2007 (diff | hist) . . (-14) . . PME-mCherryCAAX H80D
- 22:57, 2 November 2007 (diff | hist) . . (+820) . . List of entry and destination vectors
- 22:53, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 22:53, 2 November 2007 (diff | hist) . . (+34) . . N PME-mCherryCAAX (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 11:34, 31 October 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 11:33, 31 October 2007 (diff | hist) . . (+248) . . Sources (→References) (current)
- 11:32, 31 October 2007 (diff | hist) . . (+5) . . Sources (→Transposon backbone)
- 11:24, 31 October 2007 (diff | hist) . . (+150) . . Sources
- 11:20, 31 October 2007 (diff | hist) . . (+52) . . Main Page (→Links)
- 17:14, 30 October 2007 (diff | hist) . . (0) . . Main Page (→Citing the Tol2kit)
- 17:12, 30 October 2007 (diff | hist) . . (+39) . . Main Page (→Citing the Tol2kit)
- 12:28, 12 October 2007 (diff | hist) . . (+144) . . Invitrogen manual
- 03:35, 12 October 2007 (diff | hist) . . (+4) . . m Main Page (→Revision history)
- 03:35, 12 October 2007 (diff | hist) . . (-65) . . Main Page (→About this site)
- 19:06, 11 October 2007 (diff | hist) . . (+141) . . Main Page
- 19:03, 11 October 2007 (diff | hist) . . (-85) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (-41) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (+844) . . N Invitrogen manual (link to archived copy of Invitrogen manual)
- 18:54, 11 October 2007 (diff | hist) . . (-10) . . Protocols (→Donor Vectors)
- 18:54, 11 October 2007 (diff | hist) . . (-11) . . Protocols (→What you will need)
- 18:53, 11 October 2007 (diff | hist) . . (-10) . . Protocols
- 18:51, 11 October 2007 (diff | hist) . . (0) . . Main Page
- 02:22, 29 September 2007 (diff | hist) . . (+352) . . P5E-MCS (→Construction details)
- 02:14, 29 September 2007 (diff | hist) . . (+186) . . PME-MCS (→Construction details)
- 02:14, 28 September 2007 (diff | hist) . . (+3) . . List of entry and destination vectors
- 02:06, 28 September 2007 (diff | hist) . . (+52) . . N File:PME-MCS.png (Sequencher screenshot showing components of pME-MCS.) (current)
- 02:02, 28 September 2007 (diff | hist) . . (+7,945) . . N PME-MCS sequence (New page: <pre> >pME-MCS CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGATTCATTAAT...) (current)
- 23:32, 27 September 2007 (diff | hist) . . (+167) . . PME-MCS (→Construction details)
- 23:30, 27 September 2007 (diff | hist) . . (+794) . . N PME-MCS (New page: === Construction details === pME-MCS was made by PCR of the pBSII SK+ multiple cloning site, from M13F to M13R primers, followed by a BP reaction with pDONR221. Sequencing confirms that al...)
- 03:21, 24 September 2007 (diff | hist) . . (+301) . . Main Page (→Revision history)
- 03:12, 24 September 2007 (diff | hist) . . (+573) . . Sources
- 13:51, 15 September 2007 (diff | hist) . . (+447) . . N Invitrogen ccdB (New page: ccdB sequence found in pDest R4-R3. The lowercase "c" indicates a T>C mutation relative to the ccdB sequence from Genbank. <pre> ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG...) (current)
- 13:47, 15 September 2007 (diff | hist) . . (+1,091) . . Sources
- 13:36, 15 September 2007 (diff | hist) . . (+214) . . Basic Gateway principles (current)
- 13:29, 15 September 2007 (diff | hist) . . (-17) . . Main Page (→About this site)
- 13:28, 15 September 2007 (diff | hist) . . (0) . . Main Page (→About this site)
- 13:27, 15 September 2007 (diff | hist) . . (+21) . . N Components used for the Tol2kit (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately) (current)
- 13:27, 15 September 2007 (diff | hist) . . (0) . . m Sources (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately)
- 12:42, 14 September 2007 (diff | hist) . . (+82) . . List of entry and destination vectors
- 16:17, 12 September 2007 (diff | hist) . . (+11) . . m Main Page (→Citing the Tol2kit)
- 16:17, 12 September 2007 (diff | hist) . . (+62) . . Main Page (→Citing the Tol2kit)
- 11:58, 12 September 2007 (diff | hist) . . (-49) . . Main Page (→About this site)
- 13:17, 11 September 2007 (diff | hist) . . (+9) . . Main Page (→Citing the Tol2kit)
- 13:16, 11 September 2007 (diff | hist) . . (+35) . . Sample results with the Tol2kit (current)
- 13:08, 11 September 2007 (diff | hist) . . (-18) . . Basic Gateway principles
- 13:07, 11 September 2007 (diff | hist) . . (+1,322) . . Basic Gateway principles (→How we use this in the Tol2kit)
- 12:58, 11 September 2007 (diff | hist) . . (-46) . . Main Page (→About this site)
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)