Att site sequences

From Tol2Kit

(Difference between revisions)
Jump to: navigation, search
Revision as of 00:31, 10 December 2007 (edit)
Chi-bin (Talk | contribs)
(att site shared sequences)
← Previous diff
Revision as of 00:34, 10 December 2007 (edit) (undo)
Chi-bin (Talk | contribs)

Next diff →
Line 1: Line 1:
 +12-09-07 Minor edits to fix a couple of sequences and clarify names (especially the attBXX_primer sequences).
 +
== att site shared sequences == == att site shared sequences ==
Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone. Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone.
Line 14: Line 16:
== list of att sites == == list of att sites ==
-Below are all of the att sequences (attB, P, L, and R) used in the original three-part multisite Gateway system. These sequences come from the Invitrogen documentation, and we have seen a few single-base differences from the actual sequences of our clones (it's unclear whether these are documentation mistakes or mutations that have accumulated over time).+Below are all of the att sequences (attB, P, L, and R) used in the original three-part multisite Gateway system. These sequences come from the Invitrogen documentation, and we have seen a few single-base differences from the actual sequences of our clones (it's unclear whether these are documentation mistakes or mutations that have accumulated over time). Some of these differences are indicated by degenerate IUPAC codes in the sequences below.
 + 
 +The _primer sequences are for use in designing att PCR primers. Note that we use the nomenclature of the Invitrogen [[Invitrogen manual | Version D manual]] (3/7/07), not later versions.
<pre> <pre>
->attB1+>attB1_primer
GGGGACAAGTTTGTACAAAAAAGCAGGCT GGGGACAAGTTTGTACAAAAAAGCAGGCT
->attB1R+>attB1R_primer
GGGGACTGCTTTTTTGTACAAACTTG GGGGACTGCTTTTTTGTACAAACTTG
->attB2+>attB2_primer
GGGGACAGCTTTCTTGTACAAAGTGG GGGGACAGCTTTCTTGTACAAAGTGG
->attB2R+>attB2R_primer
GGGGACCACTTTGTACAAGAAAGCTGGGT GGGGACCACTTTGTACAAGAAAGCTGGGT
->attB3R+>attB3R_primer
GGGGACAACTTTGTATAATAAAGTTG GGGGACAACTTTGTATAATAAAGTTG
->attB4+>attB4_primer
GGGGACAACTTTGTATAGAAAAGTTG GGGGACAACTTTGTATAGAAAAGTTG
 +
 +>attB1
 +CAAGTTTGTACAAAAAAGCAGGCT
 +>attB2
 +ACCCAGCTTTCTTGTACAAAGTGG
 +>attB3
 +CAACTTTGTATAATAAAGTTG
 +>attB4
 +CAACTTTGTATAGAAAAGTTG
 +
>attL1 >attL1
CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACAT CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACAT
Line 41: Line 55:
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT
GATAAGCAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG GATAAGCAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG
 +
>attP1 >attP1
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATT AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATT
Line 77: Line 92:
AAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGA AAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGA
ATCAACTACTTAGATGGTATTAGTGACCTGTA ATCAACTACTTAGATGGTATTAGTGACCTGTA
 +
>attR1 >attR1
CAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATC CAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATC
Line 83: Line 99:
ACCTGTA ACCTGTA
>attR2 >attR2
-TACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTGCATATG+TACAGGTCACTAATACCATCTAAGTAGTTGRTTCATAGTGACTGCATATG
TTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTA TTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTA
ATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTCTTGTAC ATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTCTTGTAC

Revision as of 00:34, 10 December 2007

12-09-07 Minor edits to fix a couple of sequences and clarify names (especially the attBXX_primer sequences).

att site shared sequences

Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone.

>att1_shared
TTTGTACAAAAAAG
>att2_shared
CTTTCTTGTACAAAGT
>att3_shared
CAACTTTATTATACA
>att4_shared
CAACTTTGTATAGAAAAGTTG

list of att sites

Below are all of the att sequences (attB, P, L, and R) used in the original three-part multisite Gateway system. These sequences come from the Invitrogen documentation, and we have seen a few single-base differences from the actual sequences of our clones (it's unclear whether these are documentation mistakes or mutations that have accumulated over time). Some of these differences are indicated by degenerate IUPAC codes in the sequences below.

The _primer sequences are for use in designing att PCR primers. Note that we use the nomenclature of the Invitrogen Version D manual (3/7/07), not later versions.

>attB1_primer
GGGGACAAGTTTGTACAAAAAAGCAGGCT
>attB1R_primer
GGGGACTGCTTTTTTGTACAAACTTG
>attB2_primer
GGGGACAGCTTTCTTGTACAAAGTGG
>attB2R_primer
GGGGACCACTTTGTACAAGAAAGCTGGGT
>attB3R_primer
GGGGACAACTTTGTATAATAAAGTTG
>attB4_primer
GGGGACAACTTTGTATAGAAAAGTTG

>attB1
CAAGTTTGTACAAAAAAGCAGGCT
>attB2
ACCCAGCTTTCTTGTACAAAGTGG
>attB3
CAACTTTGTATAATAAAGTTG
>attB4
CAACTTTGTATAGAAAAGTTG

>attL1
CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACAT
TGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT
>attL2
ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCA
ATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG
>attL3
CAACTTTATTATACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATT
TGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTT
>attL4
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT
GATAAGCAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG

>attP1
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATT
GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACG
AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA
AAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGA
ATCAACTACTTAGATGGTATTAGTGACCTGTA
>attP1R
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT
GATAAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGAACG
AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA
AAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGA
ATCAACTACTTAGATGGTATTAGTGACCTGTA
>attP2
AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTG
ATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGCTGAACGA
GAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAA
AAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAA
TCAACTACTTAGATGGTATTAGTGACCTGTA
>attP2R
TACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTGCATATG
TTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTA
ATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTCTTGTAC
AAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACA
GGTCACTATCAGTCAAAATAAAATCATTATTT
>attP3
TACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTGCATATG
TTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTA
ATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTATTATAC
AAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACA
GGTCACTATCAGTCAAAATAAAATCATTATTT
>attP4
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT
GATAAGCAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTGAACG
AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA
AAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGA
ATCAACTACTTAGATGGTATTAGTGACCTGTA

>attR1
CAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATC
AATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAA
AACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTG
ACCTGTA
>attR2
TACAGGTCACTAATACCATCTAAGTAGTTGRTTCATAGTGACTGCATATG
TTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTA
ATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTCTTGTAC
AAAGTGG
>attR3
CCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTT
TATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCT
CGTTCAACTTTATTATACATAGTTG
>attR4
CAACTTTGTATAGAAAAGTTGAACGAGAAACGTAAAATGATATAAATATC
AATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAA
AACACAACATATCCAGTCACTATGG
Personal tools