http://tol2kit.genetics.utah.edu/index.php?title=Protocols&action=history&feed=atom
Protocols - Revision history
2024-03-28T23:48:22Z
Revision history for this page on the wiki
MediaWiki 1.27.4
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=489&oldid=prev
Kristen: /* Transformation, Plasmid Prep, and Diagnostic Digests */
2020-11-18T06:47:46Z
<p><span dir="auto"><span class="autocomment">Transformation, Plasmid Prep, and Diagnostic Digests</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 06:47, 18 November 2020</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l66" >Line 66:</td>
<td colspan="2" class="diff-lineno">Line 66:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>This reaction is plated onto ampicillin plates; carbenicillin works as well.  We typically find hundreds of colonies per plate. We do not plate the reaction before 3 pm, as satellite colonies can be a significant problem, obscuring the results of the reaction.  Plates are removed from the 37 degree incubator first thing the next morning; this provides the best chance to distinguish clear from opaque colonies.  If it is difficult to tell clear from opaque, looking at the plate in front of a dark background (we use a black refrigerator) will help.  The image below shows examples of clear and opaque colonies on the same plate.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>This reaction is plated onto ampicillin plates; carbenicillin works as well.  We typically find hundreds of colonies per plate. We do not plate the reaction before 3 pm, as satellite colonies can be a significant problem, obscuring the results of the reaction.  Plates are removed from the 37 degree incubator first thing the next morning; this provides the best chance to distinguish clear from opaque colonies.  If it is difficult to tell clear from opaque, looking at the plate in front of a dark background (we use a black refrigerator) will help.  The image below shows examples of clear and opaque colonies on the same plate.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>[[Image:<del class="diffchange diffchange-inline">clear</del>-<del class="diffchange diffchange-inline">opaque</del>.png]]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>[[Image:<ins class="diffchange diffchange-inline">opaque</ins>-<ins class="diffchange diffchange-inline">clear1120</ins>.png<ins class="diffchange diffchange-inline">|400px</ins>]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Plates can be left at room temperature until clear colonies are picked in the afternoon.  We have found that clear colonies contain the correct clone >99% of the time, while opaque colonies never contain the correct clone.  A reaction that has worked well will have a clear to opaque colony ratio of at least 3:1.  However, as long as clear colonies can be identified, the correct clone will be isolated.  As with the BP reaction, clones are tested via restriction digest; again, we generally avoid enzymes that cut within the att sites.  PvuII has been very useful for this.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Plates can be left at room temperature until clear colonies are picked in the afternoon.  We have found that clear colonies contain the correct clone >99% of the time, while opaque colonies never contain the correct clone.  A reaction that has worked well will have a clear to opaque colony ratio of at least 3:1.  However, as long as clear colonies can be identified, the correct clone will be isolated.  As with the BP reaction, clones are tested via restriction digest; again, we generally avoid enzymes that cut within the att sites.  PvuII has been very useful for this.</div></td></tr>
</table>
Kristen
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=477&oldid=prev
Chi-bin: reformatting
2010-12-18T03:14:21Z
<p>reformatting</p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:14, 18 December 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l89" >Line 89:</td>
<td colspan="2" class="diff-lineno">Line 89:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== sequence deviations ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== sequence deviations ===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>When sequencing entry clones, you may occasionally notice (as we have) <del class="diffchange diffchange-inline">that </del>a single base in an att site <del class="diffchange diffchange-inline">that differs </del>from that given by Invitrogen. Apparently, their documented sequence is not base-perfect.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>When sequencing entry clones, you may occasionally notice (as we have) a single base in an att site <ins class="diffchange diffchange-inline">differing </ins>from that given by Invitrogen. Apparently, their documented sequence is not base-perfect<ins class="diffchange diffchange-inline">. We will list these differences here as we notice them</ins>.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">We have noticed a </del>C>A change (shown in lowercase here) in the attL1 and attP1 sequences:</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>C>A change (shown in lowercase here) in the attL1 and attP1 sequences:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"><pre></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>attL1:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>attL1:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACA''a''AT</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAaAT</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>TGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>TGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>attP1:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>attP1:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACA''a''ATT</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAaATT</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACG</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACG</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>AAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGA</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>AAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGA</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ATCAACTACTTAGATGGTATTAGTGACCTGTA</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ATCAACTACTTAGATGGTATTAGTGACCTGTA</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></pre></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=476&oldid=prev
Chi-bin: added basepair changes in attL1 and attP1
2010-12-18T03:10:46Z
<p>added basepair changes in attL1 and attP1</p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 03:10, 18 December 2010</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l87" >Line 87:</td>
<td colspan="2" class="diff-lineno">Line 87:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ApE does lots of other things too--think DNA Strider on steroids. Thanks Wayne!</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>ApE does lots of other things too--think DNA Strider on steroids. Thanks Wayne!</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">=== sequence deviations ===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">When sequencing entry clones, you may occasionally notice (as we have) that a single base in an att site that differs from that given by Invitrogen. Apparently, their documented sequence is not base-perfect.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">We have noticed a C>A change (shown in lowercase here) in the attL1 and attP1 sequences:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">attL1:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACA''a''AT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">TGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">attP1:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACA''a''ATT</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACG</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">AGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATA</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">AAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGA</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">ATCAACTACTTAGATGGTATTAGTGACCTGTA</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=432&oldid=prev
Chi-bin: /* Assembling sequences for expression clones */
2007-12-19T04:29:42Z
<p><span dir="auto"><span class="autocomment">Assembling sequences for expression clones</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 04:29, 19 December 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l76" >Line 76:</td>
<td colspan="2" class="diff-lineno">Line 76:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Each of the 4 sets of att sites has a core sequence, e.g. "attB4/L4/R4_shared", which is shared between the attL, R, B, and P sites (see sequences [[att site sequences|here]]). This means that adjacent clones used to build an expression clone will have at least a 15 bp overlap at the ends. This overlap can be used to predict the sequence of the expression clone, for instance to pick diagnostic restriction digests.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Each of the 4 sets of att sites has a core sequence, e.g. "attB4/L4/R4_shared", which is shared between the attL, R, B, and P sites (see sequences [[att site sequences|here]]). This means that adjacent clones used to build an expression clone will have at least a 15 bp overlap at the ends. This overlap can be used to predict the sequence of the expression clone, for instance to pick diagnostic restriction digests.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>[[inserts and ends|Here]] are a detailed description and <del class="diffchange diffchange-inline">relevant </del>sequences.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">=== by hand or with Sequencher ===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>[[inserts and ends|Here]] are <ins class="diffchange diffchange-inline">relevant sequences (entry clone inserts, destination clone ends) and </ins>a detailed description <ins class="diffchange diffchange-inline">of how to build expression clone sequences using a simple sequence assembly program like Sequencher.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">=== using ApE ===</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">12/18/07: We have now started using Wayne Davis' really lovely shareware program [[http://www.biology.utah.edu/jorgensen/wayned/ape/ ApE]] ("A plasmid Editor"), which can calculate Gateway recombinations for you:</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">* Open sequences for the three entry clones </ins>and <ins class="diffchange diffchange-inline">destination clone (e.g. using the Genbank-format sequences provided on the wiki). (Make sure that all </ins>sequences <ins class="diffchange diffchange-inline">are marked as circular, not linear.)</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">* Select Tool>Recombination Tool..., and select the multisite Gateway prototype. </ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">* Hey presto, you have your expression clone sequence.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div> </div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">ApE does lots of other things too--think DNA Strider on steroids</ins>. <ins class="diffchange diffchange-inline">Thanks Wayne!</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=361&oldid=prev
Chi-bin: /* Assembling sequences for expression clones */
2007-11-06T04:13:08Z
<p><span dir="auto"><span class="autocomment">Assembling sequences for expression clones</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 04:13, 6 November 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l74" >Line 74:</td>
<td colspan="2" class="diff-lineno">Line 74:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Assembling sequences for expression clones ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Assembling sequences for expression clones ==</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Each of the 4 sets of att sites has a core sequence, e.g. "attB4/L4/R4_shared", which is shared between the attL, R, B, and P sites (see <del class="diffchange diffchange-inline">the </del>[[att <del class="diffchange diffchange-inline">seq list</del>|<del class="diffchange diffchange-inline">att sequence page</del>]] <del class="diffchange diffchange-inline">for sequences</del>). This means that adjacent clones used to build an expression clone will have at least a 15 bp overlap at the ends. This overlap can be used to predict the sequence of the expression clone, for instance to pick diagnostic restriction digests.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Each of the 4 sets of att sites has a core sequence, e.g. "attB4/L4/R4_shared", which is shared between the attL, R, B, and P sites (see <ins class="diffchange diffchange-inline">sequences </ins>[[att <ins class="diffchange diffchange-inline">site sequences</ins>|<ins class="diffchange diffchange-inline">here</ins>]]). This means that adjacent clones used to build an expression clone will have at least a 15 bp overlap at the ends. This overlap can be used to predict the sequence of the expression clone, for instance to pick diagnostic restriction digests.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">For a detailed description and relevant sequences, look </del>[[inserts and ends|<del class="diffchange diffchange-inline">here</del>]].</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>[[inserts and ends|<ins class="diffchange diffchange-inline">Here</ins>]] <ins class="diffchange diffchange-inline">are a detailed description and relevant sequences</ins>.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=360&oldid=prev
Chi-bin at 04:10, 6 November 2007
2007-11-06T04:10:39Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 04:10, 6 November 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l72" >Line 72:</td>
<td colspan="2" class="diff-lineno">Line 72:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Factors Affecting Reaction Efficiency ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Factors Affecting Reaction Efficiency ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Certain entry vectors seem to be less efficiently recombined in the LR recombination reaction.  The lower efficiency of the reaction will be conveyed by a lower number of transformants, as well as a lower ratio of clear to opaque colonies.  The major factor leading to lower recombination efficiency appears to be size of the insert.  Both particularly short and extremely long DNA fragments can be tricky.  Short is defined as less than 200 bases (e.g. p3E-polyA in the Tol2Kit), and long is defined as greater than 10 kb.  Although these reactions work less efficiently than others, we have not defined a lower limit for fragment length.  For example, p5E-Fse-Asc has an insert of 59 bases; this will still work in recombination reactions.  On the other hand, entry vector fragments of greater than 10 kb have been difficult to work with; it is not clear if this reflects something about the recombination reaction or the specific DNA insert.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Certain entry vectors seem to be less efficiently recombined in the LR recombination reaction.  The lower efficiency of the reaction will be conveyed by a lower number of transformants, as well as a lower ratio of clear to opaque colonies.  The major factor leading to lower recombination efficiency appears to be size of the insert.  Both particularly short and extremely long DNA fragments can be tricky.  Short is defined as less than 200 bases (e.g. p3E-polyA in the Tol2Kit), and long is defined as greater than 10 kb.  Although these reactions work less efficiently than others, we have not defined a lower limit for fragment length.  For example, p5E-Fse-Asc has an insert of 59 bases; this will still work in recombination reactions.  On the other hand, entry vector fragments of greater than 10 kb have been difficult to work with; it is not clear if this reflects something about the recombination reaction or the specific DNA insert.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">== Assembling sequences for expression clones ==</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Each of the 4 sets of att sites has a core sequence, e.g. "attB4/L4/R4_shared", which is shared between the attL, R, B, and P sites (see the [[att seq list|att sequence page]] for sequences). This means that adjacent clones used to build an expression clone will have at least a 15 bp overlap at the ends. This overlap can be used to predict the sequence of the expression clone, for instance to pick diagnostic restriction digests.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">For a detailed description and relevant sequences, look [[inserts and ends|here]].</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Injections for transgenesis ==</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=312&oldid=prev
Chi-bin at 19:03, 11 October 2007
2007-10-11T19:03:49Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 19:03, 11 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l30" >Line 30:</td>
<td colspan="2" class="diff-lineno">Line 30:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''pDONR P4-P1R and pDONR P2R-P3 (12537-023)''': empty 5' and 3' donor vectors for generation of new 5' and 3' entry clones.  Note: the catalog number provided here is for the MultiSite Gateway Three-Fragment Vector Construction Kit; it includes pDONR221 as well as a destination vector (pDest R4-R3).  This appears to be the only way to purchase the empty donor vectors at this point.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''pDONR P4-P1R and pDONR P2R-P3 (12537-023)''': empty 5' and 3' donor vectors for generation of new 5' and 3' entry clones.  Note: the catalog number provided here is for the MultiSite Gateway Three-Fragment Vector Construction Kit; it includes pDONR221 as well as a destination vector (pDest R4-R3).  This appears to be the only way to purchase the empty donor vectors at this point.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Note that the Tol2kit is based on the original three-part multisite Gateway system (as described in the [<del class="diffchange diffchange-inline">http://chien.neuro.utah.edu/pdfs/multisite_Gateway_3-07-07.pdf </del>manual <del class="diffchange diffchange-inline">from 3-07-07</del>]), in which destination vectors use attR4-R3 sites, '''not''' the new Multisite Gateway Pro system, in which all the destination vectors use attR1-R2 sites. While the donor, entry, and destination vectors are incompatible with the Pro system (different sets of att sites are used), the BP and LR enzyme mixes are still the same.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Note that the Tol2kit is based on the original three-part multisite Gateway system (as described in the [<ins class="diffchange diffchange-inline">[Invitrogen </ins>manual <ins class="diffchange diffchange-inline">| version D manual]</ins>]), in which destination vectors use attR4-R3 sites, '''not''' the new Multisite Gateway Pro system, in which all the destination vectors use attR1-R2 sites. While the donor, entry, and destination vectors are incompatible with the Pro system (different sets of att sites are used), the BP and LR enzyme mixes are still the same.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Donor Vectors ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Donor Vectors ===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The [<del class="diffchange diffchange-inline">http://chien.neuro.utah.edu/pdfs/multisite_Gateway_3-07-07.pdf </del>Invitrogen multisite Gateway manual] describes and explains the donor vectors in detail.  The one extra technical note is that the 5' donor vector (pDONR P4-P1R) can be tricky to propagate due to self-recombination.  Based on advice from the Lawson lab, we now use their [http://lawsonlab.umassmed.edu/PDFs/p4p1RPrep.pdf 5' donor vector propagation protocol].</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The [<ins class="diffchange diffchange-inline">[Invitrogen manual | </ins>Invitrogen multisite Gateway manual<ins class="diffchange diffchange-inline">]</ins>] describes and explains the donor vectors in detail.  The one extra technical note is that the 5' donor vector (pDONR P4-P1R) can be tricky to propagate due to self-recombination.  Based on advice from the Lawson lab, we now use their [http://lawsonlab.umassmed.edu/PDFs/p4p1RPrep.pdf 5' donor vector propagation protocol].</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== PCR Amplification of DNA ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== PCR Amplification of DNA ===</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=311&oldid=prev
Chi-bin at 19:01, 11 October 2007
2007-10-11T19:01:43Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 19:01, 11 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Here are optimized methods and tips from the Chien lab, adopted after trial and error, which work consistently in our hands. See the [<del class="diffchange diffchange-inline">http://chien.neuro.utah.edu/pdfs/multisite_Gateway_3-07-07.pdf </del>Invitrogen multisite Gateway manual] for all of the basic information necessary to understand and perform Gateway recombination reactions.  See also the [http://lawsonlab.umassmed.edu/gwtips.html Gateway tips] on the Lawson lab website.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Here are optimized methods and tips from the Chien lab, adopted after trial and error, which work consistently in our hands. See the [<ins class="diffchange diffchange-inline">[Invitrogen manual | </ins>Invitrogen multisite Gateway manual<ins class="diffchange diffchange-inline">]</ins>] for all of the basic information necessary to understand and perform Gateway recombination reactions.  See also the [http://lawsonlab.umassmed.edu/gwtips.html Gateway tips] on the Lawson lab website.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Please report problems or questions on the [http://tol2kit.blogspot.com Tol2kit blog].</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Please report problems or questions on the [http://tol2kit.blogspot.com Tol2kit blog].</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=309&oldid=prev
Chi-bin: /* Donor Vectors */
2007-10-11T18:54:59Z
<p><span dir="auto"><span class="autocomment">Donor Vectors</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:54, 11 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l34" >Line 34:</td>
<td colspan="2" class="diff-lineno">Line 34:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Donor Vectors ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== Donor Vectors ===</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>The [<del class="diffchange diffchange-inline">https</del>://<del class="diffchange diffchange-inline">www</del>.<del class="diffchange diffchange-inline">invitrogen</del>.<del class="diffchange diffchange-inline">com/content/sfs</del>/<del class="diffchange diffchange-inline">manuals</del>/<del class="diffchange diffchange-inline">multisite_gateway_man</del>.pdf Invitrogen multisite Gateway manual] describes and explains the donor vectors in detail.  The one extra technical note is that the 5' donor vector (pDONR P4-P1R) can be tricky to propagate due to self-recombination.  Based on advice from the Lawson lab, we now use their [http://lawsonlab.umassmed.edu/PDFs/p4p1RPrep.pdf 5' donor vector propagation protocol].</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>The [<ins class="diffchange diffchange-inline">http</ins>://<ins class="diffchange diffchange-inline">chien</ins>.<ins class="diffchange diffchange-inline">neuro</ins>.<ins class="diffchange diffchange-inline">utah.edu</ins>/<ins class="diffchange diffchange-inline">pdfs</ins>/<ins class="diffchange diffchange-inline">multisite_Gateway_3-07-07</ins>.pdf Invitrogen multisite Gateway manual] describes and explains the donor vectors in detail.  The one extra technical note is that the 5' donor vector (pDONR P4-P1R) can be tricky to propagate due to self-recombination.  Based on advice from the Lawson lab, we now use their [http://lawsonlab.umassmed.edu/PDFs/p4p1RPrep.pdf 5' donor vector propagation protocol].</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== PCR Amplification of DNA ===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>=== PCR Amplification of DNA ===</div></td></tr>
</table>
Chi-bin
http://tol2kit.genetics.utah.edu/index.php?title=Protocols&diff=308&oldid=prev
Chi-bin: /* What you will need */
2007-10-11T18:54:27Z
<p><span dir="auto"><span class="autocomment">What you will need</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 18:54, 11 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l30" >Line 30:</td>
<td colspan="2" class="diff-lineno">Line 30:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''pDONR P4-P1R and pDONR P2R-P3 (12537-023)''': empty 5' and 3' donor vectors for generation of new 5' and 3' entry clones.  Note: the catalog number provided here is for the MultiSite Gateway Three-Fragment Vector Construction Kit; it includes pDONR221 as well as a destination vector (pDest R4-R3).  This appears to be the only way to purchase the empty donor vectors at this point.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''pDONR P4-P1R and pDONR P2R-P3 (12537-023)''': empty 5' and 3' donor vectors for generation of new 5' and 3' entry clones.  Note: the catalog number provided here is for the MultiSite Gateway Three-Fragment Vector Construction Kit; it includes pDONR221 as well as a destination vector (pDest R4-R3).  This appears to be the only way to purchase the empty donor vectors at this point.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Note that the Tol2kit is based on the original three-part multisite Gateway system (as described in the [<del class="diffchange diffchange-inline">https</del>://<del class="diffchange diffchange-inline">www</del>.<del class="diffchange diffchange-inline">invitrogen</del>.<del class="diffchange diffchange-inline">com</del>/<del class="diffchange diffchange-inline">content</del>/<del class="diffchange diffchange-inline">sfs/manuals/multisite_gateway_man</del>.pdf manual from <del class="diffchange diffchange-inline">11/29/04</del>]), in which destination vectors use attR4-R3 sites, '''not''' the new Multisite Gateway Pro system, in which all the destination vectors use attR1-R2 sites. While the donor, entry, and destination vectors are incompatible with the Pro system (different sets of att sites are used), the BP and LR enzyme mixes are still the same.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Note that the Tol2kit is based on the original three-part multisite Gateway system (as described in the [<ins class="diffchange diffchange-inline">http</ins>://<ins class="diffchange diffchange-inline">chien</ins>.<ins class="diffchange diffchange-inline">neuro</ins>.<ins class="diffchange diffchange-inline">utah.edu</ins>/<ins class="diffchange diffchange-inline">pdfs</ins>/<ins class="diffchange diffchange-inline">multisite_Gateway_3-07-07</ins>.pdf manual from <ins class="diffchange diffchange-inline">3-07-07</ins>]), in which destination vectors use attR4-R3 sites, '''not''' the new Multisite Gateway Pro system, in which all the destination vectors use attR1-R2 sites. While the donor, entry, and destination vectors are incompatible with the Pro system (different sets of att sites are used), the BP and LR enzyme mixes are still the same.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== BP Reactions ==</div></td></tr>
</table>
Chi-bin