From Tol2Kit
(New page: '''Construction details'''<br> p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists o...) |
m |
||
| Line 1: | Line 1: | ||
| − | + | === Construction details === | |
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | ||
| Line 9: | Line 9: | ||
Sequencing confirms that all bases of the insert are correct. | Sequencing confirms that all bases of the insert are correct. | ||
| − | + | === Crudely annotated sequence === | |
FASTA file with the full-length sequence as well as sequences of individual components:<br> | FASTA file with the full-length sequence as well as sequences of individual components:<br> | ||
[[p5E-Fse-Asc sequence]] | [[p5E-Fse-Asc sequence]] | ||
| − | + | === Crude map === | |
Screenshot from Sequencher showing locations of components:<br> | Screenshot from Sequencher showing locations of components:<br> | ||
[[Image:p5E-Fse-Asc.png]] | [[Image:p5E-Fse-Asc.png]] | ||
Revision as of 22:56, 19 March 2007
Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crudely annotated sequence
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence
Crude map
Screenshot from Sequencher showing locations of components:
