From Tol2Kit
(New page: '''Construction details'''<br> p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists o...) |
m (→Sequence) |
||
| (2 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
| − | + | === Construction details === | |
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | ||
| Line 9: | Line 9: | ||
Sequencing confirms that all bases of the insert are correct. | Sequencing confirms that all bases of the insert are correct. | ||
| − | + | === Sequence === | |
| + | Annotated sequence, Genbank format:<br> | ||
| + | [[p5E-Fse-Asc Genbank]] | ||
| + | |||
FASTA file with the full-length sequence as well as sequences of individual components:<br> | FASTA file with the full-length sequence as well as sequences of individual components:<br> | ||
[[p5E-Fse-Asc sequence]] | [[p5E-Fse-Asc sequence]] | ||
| − | + | === Crude map === | |
Screenshot from Sequencher showing locations of components:<br> | Screenshot from Sequencher showing locations of components:<br> | ||
[[Image:p5E-Fse-Asc.png]] | [[Image:p5E-Fse-Asc.png]] | ||
Latest revision as of 04:01, 19 December 2007
Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Sequence
Annotated sequence, Genbank format:
p5E-Fse-Asc Genbank
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence
Crude map
Screenshot from Sequencher showing locations of components:
