From Tol2Kit
m |
|||
| Line 9: | Line 9: | ||
Sequencing confirms that all bases of the insert are correct. | Sequencing confirms that all bases of the insert are correct. | ||
| − | === | + | === Sequence === |
| + | Annotated sequence, Genbank format:<br> | ||
| + | [[p5E-Fse-As Genbank]] | ||
| + | |||
FASTA file with the full-length sequence as well as sequences of individual components:<br> | FASTA file with the full-length sequence as well as sequences of individual components:<br> | ||
[[p5E-Fse-Asc sequence]] | [[p5E-Fse-Asc sequence]] | ||
Revision as of 03:43, 19 December 2007
Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Sequence
Annotated sequence, Genbank format:
p5E-Fse-As Genbank
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence
Crude map
Screenshot from Sequencher showing locations of components:
