From Tol2Kit
Jump to: navigation, search
m
Line 9: Line 9:
 
Sequencing confirms that all bases of the insert are correct.
 
Sequencing confirms that all bases of the insert are correct.
  
=== Crudely annotated sequence ===
+
=== Sequence ===
 +
Annotated sequence, Genbank format:<br>
 +
[[p5E-Fse-As Genbank]]
 +
 
 
FASTA file with the full-length sequence as well as sequences of individual components:<br>
 
FASTA file with the full-length sequence as well as sequences of individual components:<br>
 
[[p5E-Fse-Asc sequence]]
 
[[p5E-Fse-Asc sequence]]

Revision as of 03:43, 19 December 2007

Construction details

p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:

GGCCGGCCCTTCGGCGCGCC

that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.

Sequence

Annotated sequence, Genbank format:
p5E-Fse-As Genbank

FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence

Crude map

Screenshot from Sequencher showing locations of components:
P5E-Fse-Asc.png