From Tol2Kit
m (→Sequence) |
|||
| Line 11: | Line 11: | ||
=== Sequence === | === Sequence === | ||
Annotated sequence, Genbank format:<br> | Annotated sequence, Genbank format:<br> | ||
| − | [[p5E-Fse- | + | [[p5E-Fse-Asc Genbank]] |
FASTA file with the full-length sequence as well as sequences of individual components:<br> | FASTA file with the full-length sequence as well as sequences of individual components:<br> | ||
Latest revision as of 04:01, 19 December 2007
Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Sequence
Annotated sequence, Genbank format:
p5E-Fse-Asc Genbank
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence
Crude map
Screenshot from Sequencher showing locations of components:
