From Tol2Kit
Revision as of 04:01, 19 December 2007 by Chi-bin (talk | contribs) (Sequence)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Construction details

p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:

GGCCGGCCCTTCGGCGCGCC

that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.

Sequence

Annotated sequence, Genbank format:
p5E-Fse-Asc Genbank

FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence

Crude map

Screenshot from Sequencher showing locations of components:
P5E-Fse-Asc.png