From Tol2Kit
Revision as of 00:01, 13 February 2007 by Chi-bin (talk | contribs) (New page: '''Construction details'''<br> p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists o...)
Construction details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crudely annotated sequence
FASTA file with the full-length sequence as well as sequences of individual components:
p5E-Fse-Asc sequence
Crude map
Screenshot from Sequencher showing locations of components:
