From Tol2Kit
(newest | oldest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 19:16, 7 February 2007 (diff | hist) . . (+57) . . N File:PDestTol2CG2.png (Sequencher screenshot showing components of pDestTol2CG2.) (current)
- 19:15, 7 February 2007 (diff | hist) . . (+19,035) . . N PDestTol2CG2 sequence (New page: <pre> >pDestTol2CG2 CACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAA TACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTT CAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGC CCTTATTCCCTTTTT...)
- 19:14, 7 February 2007 (diff | hist) . . (+546) . . N PDestTol2CG2 (New page: '''Construction details'''<br> pDestTol2CG2 was made from pDestTol2CG by cutting with AfeII/NgoMI and religating; this removed ~2kb comprising medaka tyrosinase genomic sequence and part o...)
- 19:12, 7 February 2007 (diff | hist) . . (0) . . m PDestTol2pA2 sequence (PDestTol2pA sequence moved to PDestTol2pA2 sequence: typo in original name)
- 19:12, 7 February 2007 (diff | hist) . . (+35) . . N PDestTol2pA sequence (PDestTol2pA sequence moved to PDestTol2pA2 sequence: typo in original name)
- 19:11, 7 February 2007 (diff | hist) . . (+28) . . PDestTol2pA2
- 19:09, 7 February 2007 (diff | hist) . . (-1) . . m List of entry and destination vectors
- 19:08, 7 February 2007 (diff | hist) . . (+84) . . List of entry and destination vectors
- 19:06, 7 February 2007 (diff | hist) . . (+56) . . N File:PDestTol2pA2.png (Sequencher screenshot showing components of pDestTol2pA.)
- 19:05, 7 February 2007 (diff | hist) . . (+16,113) . . N PDestTol2pA2 sequence (New page: <pre> >pDest-Tol2-pA_v2 CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTT TGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCC TTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTT GGAACAAGAGT...)
- 19:00, 7 February 2007 (diff | hist) . . (+519) . . N PDestTol2pA2 (New page: '''Construction details'''<br> pDestTol2pA2 was made from pDestTol2pA by cutting with AfeII/DraIII and religating; this removed ~2kb comprising medaka tyrosinase genomic sequence and part ...)
- 19:08, 6 February 2007 (diff | hist) . . (+66) . . List of entry and destination vectors
- 13:11, 2 February 2007 (diff | hist) . . (+217) . . Main Page
- 13:05, 2 February 2007 (diff | hist) . . (+104) . . Main Page
- 13:03, 2 February 2007 (diff | hist) . . (+187) . . List of entry and destination vectors
- 12:46, 2 February 2007 (diff | hist) . . (0) . . Basic Gateway principles (→Principles of Gateway recombination)
- 12:40, 2 February 2007 (diff | hist) . . (+37) . . Basic Gateway principles (→Principles of Gateway recombination)
- 12:40, 2 February 2007 (diff | hist) . . (+166) . . N File:BP reaction.png (Diagram of a Gateway BP reaction. A "middle" clone (pME) is constructed using PCR with gene-specific primers to add att sites, then recombination with a donor vector.)
- 12:39, 2 February 2007 (diff | hist) . . (+208) . . Basic Gateway principles (→Principles of Gateway recombination)
- 12:36, 2 February 2007 (diff | hist) . . (+142) . . Main Page
- 05:20, 2 February 2007 (diff | hist) . . (+52) . . Protocols (→LR reactions)
- 05:19, 2 February 2007 (diff | hist) . . (-21) . . File:Clear-opaque.png (current)
- 05:18, 2 February 2007 (diff | hist) . . (+129) . . N File:Clear-opaque.png (Image of colonies from LR reaction showing three clear (correct) colonies (arrowheads) and one opaque (incorrect) colony (arrow).)
- 19:52, 31 January 2007 (diff | hist) . . (-4) . . Basic Gateway principles
- 19:45, 31 January 2007 (diff | hist) . . (-1) . . Basic Gateway principles
- 19:35, 31 January 2007 (diff | hist) . . (-5) . . Basic Gateway principles
- 19:35, 31 January 2007 (diff | hist) . . (0) . . Basic Gateway principles
- 19:30, 31 January 2007 (diff | hist) . . (+6) . . Basic Gateway principles
- 19:16, 31 January 2007 (diff | hist) . . (-6) . . Basic Gateway principles
- 19:15, 31 January 2007 (diff | hist) . . (+18) . . Basic Gateway principles
- 19:06, 31 January 2007 (diff | hist) . . (+168) . . Basic Gateway principles
- 19:00, 31 January 2007 (diff | hist) . . (+108) . . N File:LR reaction.png (Diagram of a multisite Gateway LR reaction, combining 3 entry clones with the destination vector pDestTol2pA)
- 13:55, 31 January 2007 (diff | hist) . . (+218) . . List of entry and destination vectors
- 13:53, 31 January 2007 (diff | hist) . . (+6) . . List of entry and destination vectors
- 13:38, 31 January 2007 (diff | hist) . . (+66) . . List of entry and destination vectors
- 13:33, 31 January 2007 (diff | hist) . . (+2,506) . . N List of entry and destination vectors (New page: This is a test of table features... {| |+ '''Constructs in the Tol2kit v1 (Jan 2007)''' ! name !! # !! insert !! made by |- ! colspan="4" style="background:#ffdead;" |5' entry clones, ...)
- 17:35, 30 January 2007 (diff | hist) . . (+25) . . N References (New page: Coming some day. 1/30/07.) (current)
- 17:35, 30 January 2007 (diff | hist) . . (+30) . . N Sample results with the Tol2kit (New page: Coming at some point, 1/30/07.)
- 17:34, 30 January 2007 (diff | hist) . . (-15) . . Sources
- 17:33, 30 January 2007 (diff | hist) . . (+279) . . N Sources (New page: Coming soon 1/30/07. This page will talk about the provenance of some components that we have used in the Tol2kit: * fluorescent proteins (FPs): EGFP, mCherry * fusion tags used for FP su...)
- 17:30, 30 January 2007 (diff | hist) . . (+55) . . Main Page (→About this site)
- 17:29, 30 January 2007 (diff | hist) . . (+114) . . N Basic Gateway principles (New page: (content is coming soon. 1/30/07) == Principles of Gateway recombination == == How we use this in the Tol2kit ==)
- 17:27, 30 January 2007 (diff | hist) . . (+295) . . Main Page
- 17:23, 30 January 2007 (diff | hist) . . (-30) . . Main Page (→'''Welcome to the Tol2kit documentation site''')
- 17:22, 30 January 2007 (diff | hist) . . (-64) . . Main Page (→'''Welcome to the Tol2kit documentation site''')
- 17:21, 30 January 2007 (diff | hist) . . (+1,067) . . Main Page (→'''Welcome to the Tol2kit documentation site''')
- 04:35, 30 January 2007 (diff | hist) . . (+6) . . Main Page
- 04:35, 30 January 2007 (diff | hist) . . (+289) . . Main Page
- 03:06, 30 January 2007 (diff | hist) . . (-68) . . Main Page
- 00:35, 30 January 2007 (diff | hist) . . (+594) . . N Tol2Kit:About (New page: A multisite Gateway-based construction kit for building zebrafish expression vectors in a Tol2 transposon backbone. The constructs in the initial release of the Tol2kit (Jan 2007) were bu...) (current)
(newest | oldest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)