From Tol2Kit
(newest | oldest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 03:44, 19 December 2007 (diff | hist) . . (+48) . . PME-EGFPCAAX (current)
- 03:44, 19 December 2007 (diff | hist) . . (+44) . . PME-EGFP (current)
- 03:43, 19 December 2007 (diff | hist) . . (+46) . . P5E-Fse-Asc
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-MCS (current)
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-UAS (current)
- 03:42, 19 December 2007 (diff | hist) . . (+45) . . P5E-hsp70l
- 03:42, 19 December 2007 (diff | hist) . . (+47) . . P5E-CMV/SP6 (current)
- 03:41, 19 December 2007 (diff | hist) . . (+45) . . P5E-h2afx (current)
- 02:41, 19 December 2007 (diff | hist) . . (+13,669) . . N P5E-bactin2 Genbank (New page: <pre> LOCUS 299.p5E-bactin2 7950 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 02:30, 19 December 2007 (diff | hist) . . (0) . . m P5E-bactin2 (→Sequence)
- 02:30, 19 December 2007 (diff | hist) . . (+47) . . P5E-bactin2
- 03:40, 12 December 2007 (diff | hist) . . (0) . . Att site sequences (→list of att sites) (current)
- 20:21, 10 December 2007 (diff | hist) . . (+8) . . P3E-IRES-nlsEGFPpA (→Construction details)
- 20:18, 10 December 2007 (diff | hist) . . (+29) . . P3E-IRES-EGFPCAAXpA (→Construction details)
- 00:36, 10 December 2007 (diff | hist) . . (+163) . . Main Page (→Revision history)
- 00:34, 10 December 2007 (diff | hist) . . (+557) . . Att site sequences
- 00:31, 10 December 2007 (diff | hist) . . (-32) . . Att site sequences (→att site shared sequences)
- 12:11, 7 November 2007 (diff | hist) . . (+12) . . N MediaWiki:Pagetitle (New page: $1 - Tol2kit) (current)
- 04:13, 6 November 2007 (diff | hist) . . (+11) . . MediaWiki:Sidebar
- 04:13, 6 November 2007 (diff | hist) . . (-21) . . Protocols (→Assembling sequences for expression clones)
- 04:10, 6 November 2007 (diff | hist) . . (+567) . . Protocols
- 04:06, 6 November 2007 (diff | hist) . . (+60) . . Inserts and ends (→What are these sequences?) (current)
- 04:05, 6 November 2007 (diff | hist) . . (+135) . . Main Page (→Revision history)
- 04:03, 6 November 2007 (diff | hist) . . (+5) . . MediaWiki:Sidebar
- 04:03, 6 November 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 04:01, 6 November 2007 (diff | hist) . . (+52,829) . . Inserts and ends
- 03:58, 6 November 2007 (diff | hist) . . (+45) . . N File:Expression clone.png (example of expression clone sequence assembly) (current)
- 03:57, 6 November 2007 (diff | hist) . . (+480) . . Inserts and ends
- 03:53, 6 November 2007 (diff | hist) . . (+1,136) . . N Inserts and ends (New page: Below are insert sequences for all entry clones, and 5' and 3' end sequences for all destination clones. In all cases, we have included sequence up through the appropriate "att shared" seq...)
- 03:40, 6 November 2007 (diff | hist) . . (+1) . . m List of entry and destination vectors
- 03:40, 6 November 2007 (diff | hist) . . (+58) . . List of entry and destination vectors
- 03:39, 6 November 2007 (diff | hist) . . (+137) . . List of entry and destination vectors
- 02:06, 6 November 2007 (diff | hist) . . (+47) . . List of entry and destination vectors
- 23:19, 2 November 2007 (diff | hist) . . (+109) . . PME-mCherry no stop
- 23:19, 2 November 2007 (diff | hist) . . (+101) . . Main Page (→Clone distribution)
- 23:18, 2 November 2007 (diff | hist) . . (+2) . . Main Page (→'''The Tol2kit''')
- 23:17, 2 November 2007 (diff | hist) . . (+128) . . Main Page (→Revision history)
- 23:15, 2 November 2007 (diff | hist) . . (+62) . . N File:PME-mCherry no stop.png (Sequencher snapshot showing components of pME-mCherry no stop.) (current)
- 23:15, 2 November 2007 (diff | hist) . . (+9,404) . . N PME-mCherry no stop sequence (New page: <pre> >pME-mCherry-no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGC...) (current)
- 23:14, 2 November 2007 (diff | hist) . . (+492) . . N PME-mCherry no stop (New page: === Construction details === pME-mCherry no stop was made by PCR amplification of mCherry, using primers that add att sites, followed by a BP reaction. Sequencing confirms that all bases ...)
- 23:13, 2 November 2007 (diff | hist) . . (+61) . . N File:PME-EGFP no stop.png (Sequencher screenshot showing components of pME-EGFP no stop.) (current)
- 23:12, 2 November 2007 (diff | hist) . . (+9,625) . . N PME-EGFP no stop sequence (New page: <pre> >pME-EGFP_no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGA...) (current)
- 23:11, 2 November 2007 (diff | hist) . . (+623) . . N PME-EGFP no stop (New page: === Construction details === pME-EGFP no stop was made by PCR amplification of the EGFP insert from a pCS2-based plasmid, using primers that add att sites, followed by a BP reaction. Sequ...)
- 23:09, 2 November 2007 (diff | hist) . . (+6,958) . . PME-mCherryCAAX sequence H80D (current)
- 23:07, 2 November 2007 (diff | hist) . . (+719) . . PME-mCherryCAAX
- 23:03, 2 November 2007 (diff | hist) . . (+65) . . N File:PME-mCherryCAAX H80D.png (Sequencher screenshot showing components of pME-mCherryCAAX H80D.) (current)
- 23:03, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crude map) (current)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name) (current)
- 23:00, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence H80D (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name)
- 23:00, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 22:59, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name)
- 22:59, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name) (current)
- 22:59, 2 November 2007 (diff | hist) . . (-14) . . PME-mCherryCAAX H80D
- 22:57, 2 November 2007 (diff | hist) . . (+820) . . List of entry and destination vectors
- 22:53, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 22:53, 2 November 2007 (diff | hist) . . (+34) . . N PME-mCherryCAAX (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 11:34, 31 October 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 11:33, 31 October 2007 (diff | hist) . . (+248) . . Sources (→References) (current)
- 11:32, 31 October 2007 (diff | hist) . . (+5) . . Sources (→Transposon backbone)
- 11:24, 31 October 2007 (diff | hist) . . (+150) . . Sources
- 11:20, 31 October 2007 (diff | hist) . . (+52) . . Main Page (→Links)
- 17:14, 30 October 2007 (diff | hist) . . (0) . . Main Page (→Citing the Tol2kit)
- 17:12, 30 October 2007 (diff | hist) . . (+39) . . Main Page (→Citing the Tol2kit)
- 12:28, 12 October 2007 (diff | hist) . . (+144) . . Invitrogen manual
- 03:35, 12 October 2007 (diff | hist) . . (+4) . . m Main Page (→Revision history)
- 03:35, 12 October 2007 (diff | hist) . . (-65) . . Main Page (→About this site)
- 19:06, 11 October 2007 (diff | hist) . . (+141) . . Main Page
- 19:03, 11 October 2007 (diff | hist) . . (-85) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (-41) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (+844) . . N Invitrogen manual (link to archived copy of Invitrogen manual)
- 18:54, 11 October 2007 (diff | hist) . . (-10) . . Protocols (→Donor Vectors)
- 18:54, 11 October 2007 (diff | hist) . . (-11) . . Protocols (→What you will need)
- 18:53, 11 October 2007 (diff | hist) . . (-10) . . Protocols
- 18:51, 11 October 2007 (diff | hist) . . (0) . . Main Page
- 02:22, 29 September 2007 (diff | hist) . . (+352) . . P5E-MCS (→Construction details)
- 02:14, 29 September 2007 (diff | hist) . . (+186) . . PME-MCS (→Construction details)
- 02:14, 28 September 2007 (diff | hist) . . (+3) . . List of entry and destination vectors
- 02:06, 28 September 2007 (diff | hist) . . (+52) . . N File:PME-MCS.png (Sequencher screenshot showing components of pME-MCS.) (current)
- 02:02, 28 September 2007 (diff | hist) . . (+7,945) . . N PME-MCS sequence (New page: <pre> >pME-MCS CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGATTCATTAAT...) (current)
- 23:32, 27 September 2007 (diff | hist) . . (+167) . . PME-MCS (→Construction details)
- 23:30, 27 September 2007 (diff | hist) . . (+794) . . N PME-MCS (New page: === Construction details === pME-MCS was made by PCR of the pBSII SK+ multiple cloning site, from M13F to M13R primers, followed by a BP reaction with pDONR221. Sequencing confirms that al...)
- 03:21, 24 September 2007 (diff | hist) . . (+301) . . Main Page (→Revision history)
- 03:12, 24 September 2007 (diff | hist) . . (+573) . . Sources
- 13:51, 15 September 2007 (diff | hist) . . (+447) . . N Invitrogen ccdB (New page: ccdB sequence found in pDest R4-R3. The lowercase "c" indicates a T>C mutation relative to the ccdB sequence from Genbank. <pre> ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG...) (current)
- 13:47, 15 September 2007 (diff | hist) . . (+1,091) . . Sources
- 13:36, 15 September 2007 (diff | hist) . . (+214) . . Basic Gateway principles (current)
- 13:29, 15 September 2007 (diff | hist) . . (-17) . . Main Page (→About this site)
- 13:28, 15 September 2007 (diff | hist) . . (0) . . Main Page (→About this site)
- 13:27, 15 September 2007 (diff | hist) . . (+21) . . N Components used for the Tol2kit (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately) (current)
- 13:27, 15 September 2007 (diff | hist) . . (0) . . m Sources (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately)
- 12:42, 14 September 2007 (diff | hist) . . (+82) . . List of entry and destination vectors
- 16:17, 12 September 2007 (diff | hist) . . (+11) . . m Main Page (→Citing the Tol2kit)
- 16:17, 12 September 2007 (diff | hist) . . (+62) . . Main Page (→Citing the Tol2kit)
- 11:58, 12 September 2007 (diff | hist) . . (-49) . . Main Page (→About this site)
- 13:17, 11 September 2007 (diff | hist) . . (+9) . . Main Page (→Citing the Tol2kit)
- 13:16, 11 September 2007 (diff | hist) . . (+35) . . Sample results with the Tol2kit (current)
- 13:08, 11 September 2007 (diff | hist) . . (-18) . . Basic Gateway principles
- 13:07, 11 September 2007 (diff | hist) . . (+1,322) . . Basic Gateway principles (→How we use this in the Tol2kit)
- 12:58, 11 September 2007 (diff | hist) . . (-46) . . Main Page (→About this site)
(newest | oldest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)