From Tol2Kit
(newest | oldest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 04:18, 19 December 2007 (diff | hist) . . (-1) . . m List of entry and destination vectors
- 04:18, 19 December 2007 (diff | hist) . . (+73) . . List of entry and destination vectors
- 04:18, 19 December 2007 (diff | hist) . . (+9,907) . . PCS2FA-transposase Genbank (current)
- 04:15, 19 December 2007 (diff | hist) . . (+12) . . N PCS2FA-transposase Genbank (New page: <pre> </pre>)
- 04:14, 19 December 2007 (diff | hist) . . (+54) . . PCS2FA-transposase (current)
- 04:12, 19 December 2007 (diff | hist) . . (+14,583) . . N PDestTol2CG2 Genbank (New page: <pre> LOCUS 395.pDestTol2CG2 7796 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:12, 19 December 2007 (diff | hist) . . (+11,547) . . N PDestTol2pA2 Genbank (New page: <pre> LOCUS 394.pDestTol2pA2 5883 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:11, 19 December 2007 (diff | hist) . . (+8,737) . . N P3E-IRES-nlsEGFPpA Genbank (New page: <pre> LOCUS 391.p3E-IRES-nlsEGFPpA 4248 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:11, 19 December 2007 (diff | hist) . . (+8,763) . . N P3E-IRES-EGFPCAAXpA Genbank (New page: <pre> LOCUS 390.p3E-IRES-EGFPCAAXpA 4250 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:10, 19 December 2007 (diff | hist) . . (+8,717) . . N P3E-IRES-EGFPpA Genbank (New page: <pre> LOCUS 389.p3E-IRES-EGFPpA 4219 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Par...) (current)
- 04:10, 19 December 2007 (diff | hist) . . (+7,243) . . N P3E-mCherrypA Genbank (New page: <pre> LOCUS 388.p3E-mCherrypA 3586 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Paran...) (current)
- 04:09, 19 December 2007 (diff | hist) . . (+7,621) . . N P3E-EGFPpA Genbank (New page: <pre> LOCUS 366.p3E-EGFPpA 3634 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant J...) (current)
- 04:09, 19 December 2007 (diff | hist) . . (+6,663) . . N P3E-MTpA Genbank (New page: <pre> LOCUS 229.p3E-MT-pA 3151 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,106) . . N P3E-polyA Genbank (New page: <pre> LOCUS 302.p3E-polyA 2838 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,651) . . N PME-mCherry no stop Genbank (New page: <pre> LOCUS 456.pME-mCherry-no stop 3258 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,888) . . N PME-EGFP no stop Genbank (New page: <pre> LOCUS 455.pME-EGFP-no stop 3324 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Pa...) (current)
- 04:07, 19 December 2007 (diff | hist) . . (+6,900) . . N PME-mCherryCAAX Genbank (New page: <pre> LOCUS 450.pME-mCherryCAAX 3321 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Para...)
- 04:06, 19 December 2007 (diff | hist) . . (+6,527) . . N PME-MCS Genbank (New page: <pre> LOCUS 237.pME-MCS 2765 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, ...) (current)
- 04:06, 19 December 2007 (diff | hist) . . (+6,737) . . N PME-Gal4VP16 Genbank (New page: <pre> LOCUS 387.Gal4VP16 3204 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM,...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+7,297) . . N PME-H2AmCherry Genbank (New page: <pre> LOCUS 234.pME-H2A-mCherry 3651 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Par...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+6,842) . . N PME-nlsmCherry Genbank (New page: <pre> LOCUS 233.pME-nlsmCherry 3288 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Para...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+6,638) . . N PME-mCherry Genbank (New page: <pre> LOCUS 386.pME-mCherry 3261 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:04, 19 December 2007 (diff | hist) . . (+7,052) . . N PME-nlsEGFP Genbank (New page: <pre> LOCUS 385.pME-nlsEGFP 3342 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:03, 19 December 2007 (diff | hist) . . (+7,080) . . N PME-EGFPCAAX Genbank (New page: <pre> LOCUS 384.pME-EGFPCAAX 3345 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:02, 19 December 2007 (diff | hist) . . (+7,047) . . N PME-EGFP Genbank (New page: <pre> LOCUS 383.pME-EGFP 3327 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM,...) (current)
- 04:02, 19 December 2007 (diff | hist) . . (+5,859) . . N P5E-Fse-Asc Genbank (New page: <pre> LOCUS 381.p5E-Fse-Asc 2663 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+1) . . m P5E-Fse-Asc (→Sequence) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+6,530) . . N P5E-MCS Genbank (New page: <pre> LOCUS 228.p5E-MCS 2810 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, ...) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+7,318) . . N P5E-UAS Genbank (New page: <pre> LOCUS 327.p5E-UAS 3126 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yo...) (current)
- 03:59, 19 December 2007 (diff | hist) . . (+7,797) . . N P5E-hsp70l Genbank (New page: <pre> LOCUS 222.p5E-hsp70 4163 bp ds-DNA circular 09-DEC-2007 DEFINITION REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...)
- 03:59, 19 December 2007 (diff | hist) . . (+7,501) . . N P5E-CMV-SP6 Genbank (New page: <pre> LOCUS 382.p5E-CMV/SP6 3704 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 03:57, 19 December 2007 (diff | hist) . . (+7,428) . . N P5E-h2afx Genbank (New page: <pre> LOCUS 380.p5E-h2afx 3604 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 03:55, 19 December 2007 (diff | hist) . . (+48) . . PDestTol2CG2 (current)
- 03:55, 19 December 2007 (diff | hist) . . (+48) . . PDestTol2pA2 (current)
- 03:54, 19 December 2007 (diff | hist) . . (+54) . . P3E-IRES-nlsEGFPpA
- 03:54, 19 December 2007 (diff | hist) . . (+55) . . P3E-IRES-EGFPCAAXpA
- 03:53, 19 December 2007 (diff | hist) . . (+51) . . P3E-IRES-EGFPpA
- 03:53, 19 December 2007 (diff | hist) . . (+49) . . P3E-mCherrypA (current)
- 03:52, 19 December 2007 (diff | hist) . . (+46) . . P3E-EGFPpA (current)
- 03:52, 19 December 2007 (diff | hist) . . (+44) . . P3E-MTpA (current)
- 03:51, 19 December 2007 (diff | hist) . . (+45) . . P3E-polyA (current)
- 03:49, 19 December 2007 (diff | hist) . . (+55) . . PME-mCherry no stop (current)
- 03:48, 19 December 2007 (diff | hist) . . (+52) . . PME-EGFP no stop (current)
- 03:48, 19 December 2007 (diff | hist) . . (+51) . . PME-mCherryCAAX
- 03:48, 19 December 2007 (diff | hist) . . (+43) . . PME-MCS
- 03:47, 19 December 2007 (diff | hist) . . (+48) . . PME-Gal4VP16
- 03:46, 19 December 2007 (diff | hist) . . (+50) . . PME-H2AmCherry
- 03:46, 19 December 2007 (diff | hist) . . (+50) . . PME-nlsmCherry (current)
- 03:46, 19 December 2007 (diff | hist) . . (+47) . . PME-mCherry (current)
- 03:45, 19 December 2007 (diff | hist) . . (+47) . . PME-nlsEGFP (current)
- 03:44, 19 December 2007 (diff | hist) . . (+48) . . PME-EGFPCAAX (current)
- 03:44, 19 December 2007 (diff | hist) . . (+44) . . PME-EGFP (current)
- 03:43, 19 December 2007 (diff | hist) . . (+46) . . P5E-Fse-Asc
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-MCS (current)
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-UAS (current)
- 03:42, 19 December 2007 (diff | hist) . . (+45) . . P5E-hsp70l
- 03:42, 19 December 2007 (diff | hist) . . (+47) . . P5E-CMV/SP6 (current)
- 03:41, 19 December 2007 (diff | hist) . . (+45) . . P5E-h2afx (current)
- 02:41, 19 December 2007 (diff | hist) . . (+13,669) . . N P5E-bactin2 Genbank (New page: <pre> LOCUS 299.p5E-bactin2 7950 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 02:30, 19 December 2007 (diff | hist) . . (0) . . m P5E-bactin2 (→Sequence)
- 02:30, 19 December 2007 (diff | hist) . . (+47) . . P5E-bactin2
- 03:40, 12 December 2007 (diff | hist) . . (0) . . Att site sequences (→list of att sites) (current)
- 20:21, 10 December 2007 (diff | hist) . . (+8) . . P3E-IRES-nlsEGFPpA (→Construction details)
- 20:18, 10 December 2007 (diff | hist) . . (+29) . . P3E-IRES-EGFPCAAXpA (→Construction details)
- 00:36, 10 December 2007 (diff | hist) . . (+163) . . Main Page (→Revision history)
- 00:34, 10 December 2007 (diff | hist) . . (+557) . . Att site sequences
- 00:31, 10 December 2007 (diff | hist) . . (-32) . . Att site sequences (→att site shared sequences)
- 12:11, 7 November 2007 (diff | hist) . . (+12) . . N MediaWiki:Pagetitle (New page: $1 - Tol2kit) (current)
- 04:13, 6 November 2007 (diff | hist) . . (+11) . . MediaWiki:Sidebar
- 04:13, 6 November 2007 (diff | hist) . . (-21) . . Protocols (→Assembling sequences for expression clones)
- 04:10, 6 November 2007 (diff | hist) . . (+567) . . Protocols
- 04:06, 6 November 2007 (diff | hist) . . (+60) . . Inserts and ends (→What are these sequences?) (current)
- 04:05, 6 November 2007 (diff | hist) . . (+135) . . Main Page (→Revision history)
- 04:03, 6 November 2007 (diff | hist) . . (+5) . . MediaWiki:Sidebar
- 04:03, 6 November 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 04:01, 6 November 2007 (diff | hist) . . (+52,829) . . Inserts and ends
- 03:58, 6 November 2007 (diff | hist) . . (+45) . . N File:Expression clone.png (example of expression clone sequence assembly) (current)
- 03:57, 6 November 2007 (diff | hist) . . (+480) . . Inserts and ends
- 03:53, 6 November 2007 (diff | hist) . . (+1,136) . . N Inserts and ends (New page: Below are insert sequences for all entry clones, and 5' and 3' end sequences for all destination clones. In all cases, we have included sequence up through the appropriate "att shared" seq...)
- 03:40, 6 November 2007 (diff | hist) . . (+1) . . m List of entry and destination vectors
- 03:40, 6 November 2007 (diff | hist) . . (+58) . . List of entry and destination vectors
- 03:39, 6 November 2007 (diff | hist) . . (+137) . . List of entry and destination vectors
- 02:06, 6 November 2007 (diff | hist) . . (+47) . . List of entry and destination vectors
- 23:19, 2 November 2007 (diff | hist) . . (+109) . . PME-mCherry no stop
- 23:19, 2 November 2007 (diff | hist) . . (+101) . . Main Page (→Clone distribution)
- 23:18, 2 November 2007 (diff | hist) . . (+2) . . Main Page (→'''The Tol2kit''')
- 23:17, 2 November 2007 (diff | hist) . . (+128) . . Main Page (→Revision history)
- 23:15, 2 November 2007 (diff | hist) . . (+62) . . N File:PME-mCherry no stop.png (Sequencher snapshot showing components of pME-mCherry no stop.) (current)
- 23:15, 2 November 2007 (diff | hist) . . (+9,404) . . N PME-mCherry no stop sequence (New page: <pre> >pME-mCherry-no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGC...) (current)
- 23:14, 2 November 2007 (diff | hist) . . (+492) . . N PME-mCherry no stop (New page: === Construction details === pME-mCherry no stop was made by PCR amplification of mCherry, using primers that add att sites, followed by a BP reaction. Sequencing confirms that all bases ...)
- 23:13, 2 November 2007 (diff | hist) . . (+61) . . N File:PME-EGFP no stop.png (Sequencher screenshot showing components of pME-EGFP no stop.) (current)
- 23:12, 2 November 2007 (diff | hist) . . (+9,625) . . N PME-EGFP no stop sequence (New page: <pre> >pME-EGFP_no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGA...) (current)
- 23:11, 2 November 2007 (diff | hist) . . (+623) . . N PME-EGFP no stop (New page: === Construction details === pME-EGFP no stop was made by PCR amplification of the EGFP insert from a pCS2-based plasmid, using primers that add att sites, followed by a BP reaction. Sequ...)
- 23:09, 2 November 2007 (diff | hist) . . (+6,958) . . PME-mCherryCAAX sequence H80D (current)
- 23:07, 2 November 2007 (diff | hist) . . (+719) . . PME-mCherryCAAX
- 23:03, 2 November 2007 (diff | hist) . . (+65) . . N File:PME-mCherryCAAX H80D.png (Sequencher screenshot showing components of pME-mCherryCAAX H80D.) (current)
- 23:03, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crude map) (current)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 23:00, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence H80D (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name) (current)
(newest | oldest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)