From Tol2Kit
(newest | oldest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 18:49, 17 August 2011 (diff | hist) . . (+22) . . P3E-IRES-EGFPCAAXpA (→Construction details) (current)
- 18:48, 17 August 2011 (diff | hist) . . (+22) . . P3E-IRES-EGFPpA (→Construction details) (current)
- 18:47, 17 August 2011 (diff | hist) . . (+22) . . P3E-IRES-nlsEGFPpA (→Construction details) (current)
- 03:14, 18 December 2010 (diff | hist) . . (+35) . . Protocols (reformatting)
- 03:10, 18 December 2010 (diff | hist) . . (+689) . . Protocols (added basepair changes in attL1 and attP1)
- 17:24, 7 March 2010 (diff | hist) . . (+303) . . PME-Gal4VP16 (→Construction details) (current)
- 17:18, 7 March 2010 (diff | hist) . . (+301) . . Main Page (→Revision history)
- 17:15, 7 March 2010 (diff | hist) . . (+37) . . PME-Gal4VP16 (→Construction details)
- 19:19, 22 January 2010 (diff | hist) . . (+179) . . PME-MCS (→Sequence) (current)
- 19:16, 22 January 2010 (diff | hist) . . (+161) . . PME-MCS (→Sequence)
- 11:59, 12 October 2009 (diff | hist) . . (+191) . . Main Page (→Revision history)
- 11:56, 12 October 2009 (diff | hist) . . (0) . . PME-mCherryCAAX Genbank (current)
- 11:55, 12 October 2009 (diff | hist) . . (+10) . . PME-mCherryCAAX (current)
- 11:52, 12 October 2009 (diff | hist) . . (+142) . . PME-mCherryCAAX (→Construction details)
- 11:50, 12 October 2009 (diff | hist) . . (-2) . . List of entry and destination vectors (current)
- 11:50, 12 October 2009 (diff | hist) . . (+136) . . List of entry and destination vectors
- 11:48, 12 October 2009 (diff | hist) . . (+122) . . List of entry and destination vectors
- 04:07, 7 May 2009 (diff | hist) . . (+4) . . Main Page (→Revision history)
- 04:06, 7 May 2009 (diff | hist) . . (+137) . . Main Page (→Revision history)
- 04:04, 7 May 2009 (diff | hist) . . (-6) . . Main Page (→Citing the Tol2kit)
- 14:35, 28 April 2009 (diff | hist) . . (0) . . List of entry and destination vectors
- 03:04, 25 April 2009 (diff | hist) . . (-8) . . List of entry and destination vectors
- 17:44, 23 August 2008 (diff | hist) . . (+188) . . PME-mCherryCAAX (→Construction details)
- 17:34, 22 August 2008 (diff | hist) . . (0) . . P5E-bactin2 (→Construction details) (current)
- 16:08, 11 April 2008 (diff | hist) . . (-1) . . P5E-UAS sequence (current)
- 12:12, 1 April 2008 (diff | hist) . . (+1) . . List of entry and destination vectors
- 12:03, 1 April 2008 (diff | hist) . . (+14) . . P5E-hsp70l (→Construction details) (current)
- 12:03, 1 April 2008 (diff | hist) . . (-1) . . P5E-hsp70l (→Construction details)
- 12:02, 1 April 2008 (diff | hist) . . (-10) . . P5E-hsp70l (→Construction details)
- 12:02, 1 April 2008 (diff | hist) . . (+3) . . P5E-hsp70l sequence (current)
- 12:01, 1 April 2008 (diff | hist) . . (+2) . . P5E-hsp70l Genbank (current)
- 12:00, 1 April 2008 (diff | hist) . . (+189) . . P5E-hsp70l
- 11:59, 1 April 2008 (diff | hist) . . (0) . . m P5E-hsp70l sequence (P5E-hsp70 sequence moved to P5E-hsp70l sequence: Changing name to reflect official ZFIN gene name "hsp70l".)
- 11:59, 1 April 2008 (diff | hist) . . (+33) . . N P5E-hsp70 sequence (P5E-hsp70 sequence moved to P5E-hsp70l sequence: Changing name to reflect official ZFIN gene name "hsp70l".) (current)
- 11:58, 1 April 2008 (diff | hist) . . (+32) . . N P5E-hsp70 Genbank (P5E-hsp70 Genbank moved to P5E-hsp70l Genbank: Changing name to reflect official ZFIN gene name "hsp70l".) (current)
- 11:58, 1 April 2008 (diff | hist) . . (0) . . m P5E-hsp70l Genbank (P5E-hsp70 Genbank moved to P5E-hsp70l Genbank: Changing name to reflect official ZFIN gene name "hsp70l".)
- 11:57, 1 April 2008 (diff | hist) . . (0) . . m P5E-hsp70l (P5E-hsp70 moved to P5E-hsp70l: Changing name to match official ZFIN gene name)
- 11:57, 1 April 2008 (diff | hist) . . (+24) . . N P5E-hsp70 (P5E-hsp70 moved to P5E-hsp70l: Changing name to match official ZFIN gene name) (current)
- 11:56, 1 April 2008 (diff | hist) . . (-1) . . List of entry and destination vectors
- 11:55, 1 April 2008 (diff | hist) . . (+3) . . List of entry and destination vectors
- 11:55, 1 April 2008 (diff | hist) . . (+35) . . PME-H2AmCherry (→Construction details) (current)
- 04:42, 19 December 2007 (diff | hist) . . (+143) . . Main Page (→Revision history)
- 04:40, 19 December 2007 (diff | hist) . . (-94) . . MediaWiki:Sidebar (current)
- 04:37, 19 December 2007 (diff | hist) . . (0) . . MediaWiki:Sidebar
- 04:34, 19 December 2007 (diff | hist) . . (+38) . . MediaWiki:Sidebar
- 04:33, 19 December 2007 (diff | hist) . . (-36) . . MediaWiki:Sidebar
- 04:33, 19 December 2007 (diff | hist) . . (+56) . . N Sandbox (New page: Protocols#Assembling sequences for expression clones) (current)
- 04:32, 19 December 2007 (diff | hist) . . (+36) . . MediaWiki:Sidebar
- 04:29, 19 December 2007 (diff | hist) . . (+829) . . Protocols (→Assembling sequences for expression clones)
- 04:19, 19 December 2007 (diff | hist) . . (+87) . . Main Page (→Revision history)
- 04:18, 19 December 2007 (diff | hist) . . (-1) . . m List of entry and destination vectors
- 04:18, 19 December 2007 (diff | hist) . . (+73) . . List of entry and destination vectors
- 04:18, 19 December 2007 (diff | hist) . . (+9,907) . . PCS2FA-transposase Genbank (current)
- 04:15, 19 December 2007 (diff | hist) . . (+12) . . N PCS2FA-transposase Genbank (New page: <pre> </pre>)
- 04:14, 19 December 2007 (diff | hist) . . (+54) . . PCS2FA-transposase (current)
- 04:12, 19 December 2007 (diff | hist) . . (+14,583) . . N PDestTol2CG2 Genbank (New page: <pre> LOCUS 395.pDestTol2CG2 7796 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:12, 19 December 2007 (diff | hist) . . (+11,547) . . N PDestTol2pA2 Genbank (New page: <pre> LOCUS 394.pDestTol2pA2 5883 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:11, 19 December 2007 (diff | hist) . . (+8,737) . . N P3E-IRES-nlsEGFPpA Genbank (New page: <pre> LOCUS 391.p3E-IRES-nlsEGFPpA 4248 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:11, 19 December 2007 (diff | hist) . . (+8,763) . . N P3E-IRES-EGFPCAAXpA Genbank (New page: <pre> LOCUS 390.p3E-IRES-EGFPCAAXpA 4250 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:10, 19 December 2007 (diff | hist) . . (+8,717) . . N P3E-IRES-EGFPpA Genbank (New page: <pre> LOCUS 389.p3E-IRES-EGFPpA 4219 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Par...) (current)
- 04:10, 19 December 2007 (diff | hist) . . (+7,243) . . N P3E-mCherrypA Genbank (New page: <pre> LOCUS 388.p3E-mCherrypA 3586 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Paran...) (current)
- 04:09, 19 December 2007 (diff | hist) . . (+7,621) . . N P3E-EGFPpA Genbank (New page: <pre> LOCUS 366.p3E-EGFPpA 3634 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant J...) (current)
- 04:09, 19 December 2007 (diff | hist) . . (+6,663) . . N P3E-MTpA Genbank (New page: <pre> LOCUS 229.p3E-MT-pA 3151 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,106) . . N P3E-polyA Genbank (New page: <pre> LOCUS 302.p3E-polyA 2838 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,651) . . N PME-mCherry no stop Genbank (New page: <pre> LOCUS 456.pME-mCherry-no stop 3258 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...) (current)
- 04:08, 19 December 2007 (diff | hist) . . (+6,888) . . N PME-EGFP no stop Genbank (New page: <pre> LOCUS 455.pME-EGFP-no stop 3324 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Pa...) (current)
- 04:07, 19 December 2007 (diff | hist) . . (+6,900) . . N PME-mCherryCAAX Genbank (New page: <pre> LOCUS 450.pME-mCherryCAAX 3321 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Para...)
- 04:06, 19 December 2007 (diff | hist) . . (+6,527) . . N PME-MCS Genbank (New page: <pre> LOCUS 237.pME-MCS 2765 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, ...) (current)
- 04:06, 19 December 2007 (diff | hist) . . (+6,737) . . N PME-Gal4VP16 Genbank (New page: <pre> LOCUS 387.Gal4VP16 3204 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM,...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+7,297) . . N PME-H2AmCherry Genbank (New page: <pre> LOCUS 234.pME-H2A-mCherry 3651 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Par...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+6,842) . . N PME-nlsmCherry Genbank (New page: <pre> LOCUS 233.pME-nlsmCherry 3288 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Para...) (current)
- 04:05, 19 December 2007 (diff | hist) . . (+6,638) . . N PME-mCherry Genbank (New page: <pre> LOCUS 386.pME-mCherry 3261 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:04, 19 December 2007 (diff | hist) . . (+7,052) . . N PME-nlsEGFP Genbank (New page: <pre> LOCUS 385.pME-nlsEGFP 3342 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:03, 19 December 2007 (diff | hist) . . (+7,080) . . N PME-EGFPCAAX Genbank (New page: <pre> LOCUS 384.pME-EGFPCAAX 3345 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant...) (current)
- 04:02, 19 December 2007 (diff | hist) . . (+7,047) . . N PME-EGFP Genbank (New page: <pre> LOCUS 383.pME-EGFP 3327 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM,...) (current)
- 04:02, 19 December 2007 (diff | hist) . . (+5,859) . . N P5E-Fse-Asc Genbank (New page: <pre> LOCUS 381.p5E-Fse-Asc 2663 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+1) . . m P5E-Fse-Asc (→Sequence) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+6,530) . . N P5E-MCS Genbank (New page: <pre> LOCUS 228.p5E-MCS 2810 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, ...) (current)
- 04:01, 19 December 2007 (diff | hist) . . (+7,318) . . N P5E-UAS Genbank (New page: <pre> LOCUS 327.p5E-UAS 3126 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM, Yo...) (current)
- 03:59, 19 December 2007 (diff | hist) . . (+7,797) . . N P5E-hsp70l Genbank (New page: <pre> LOCUS 222.p5E-hsp70 4163 bp ds-DNA circular 09-DEC-2007 DEFINITION REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, ...)
- 03:59, 19 December 2007 (diff | hist) . . (+7,501) . . N P5E-CMV-SP6 Genbank (New page: <pre> LOCUS 382.p5E-CMV/SP6 3704 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 03:57, 19 December 2007 (diff | hist) . . (+7,428) . . N P5E-h2afx Genbank (New page: <pre> LOCUS 380.p5E-h2afx 3604 bp ds-DNA circular 18-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant JM...) (current)
- 03:55, 19 December 2007 (diff | hist) . . (+48) . . PDestTol2CG2 (current)
- 03:55, 19 December 2007 (diff | hist) . . (+48) . . PDestTol2pA2 (current)
- 03:54, 19 December 2007 (diff | hist) . . (+54) . . P3E-IRES-nlsEGFPpA
- 03:54, 19 December 2007 (diff | hist) . . (+55) . . P3E-IRES-EGFPCAAXpA
- 03:53, 19 December 2007 (diff | hist) . . (+51) . . P3E-IRES-EGFPpA
- 03:53, 19 December 2007 (diff | hist) . . (+49) . . P3E-mCherrypA (current)
- 03:52, 19 December 2007 (diff | hist) . . (+46) . . P3E-EGFPpA (current)
- 03:52, 19 December 2007 (diff | hist) . . (+44) . . P3E-MTpA (current)
- 03:51, 19 December 2007 (diff | hist) . . (+45) . . P3E-polyA (current)
- 03:49, 19 December 2007 (diff | hist) . . (+55) . . PME-mCherry no stop (current)
- 03:48, 19 December 2007 (diff | hist) . . (+52) . . PME-EGFP no stop (current)
- 03:48, 19 December 2007 (diff | hist) . . (+51) . . PME-mCherryCAAX
- 03:48, 19 December 2007 (diff | hist) . . (+43) . . PME-MCS
- 03:47, 19 December 2007 (diff | hist) . . (+48) . . PME-Gal4VP16
- 03:46, 19 December 2007 (diff | hist) . . (+50) . . PME-H2AmCherry
- 03:46, 19 December 2007 (diff | hist) . . (+50) . . PME-nlsmCherry (current)
- 03:46, 19 December 2007 (diff | hist) . . (+47) . . PME-mCherry (current)
- 03:45, 19 December 2007 (diff | hist) . . (+47) . . PME-nlsEGFP (current)
- 03:44, 19 December 2007 (diff | hist) . . (+48) . . PME-EGFPCAAX (current)
- 03:44, 19 December 2007 (diff | hist) . . (+44) . . PME-EGFP (current)
- 03:43, 19 December 2007 (diff | hist) . . (+46) . . P5E-Fse-Asc
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-MCS (current)
- 03:43, 19 December 2007 (diff | hist) . . (+43) . . P5E-UAS (current)
- 03:42, 19 December 2007 (diff | hist) . . (+45) . . P5E-hsp70l
- 03:42, 19 December 2007 (diff | hist) . . (+47) . . P5E-CMV/SP6 (current)
- 03:41, 19 December 2007 (diff | hist) . . (+45) . . P5E-h2afx (current)
- 02:41, 19 December 2007 (diff | hist) . . (+13,669) . . N P5E-bactin2 Genbank (New page: <pre> LOCUS 299.p5E-bactin2 7950 bp ds-DNA circular 10-DEC-2007 REFERENCE 1 AUTHORS Kwan KM, Fujimoto E, Grabher C, Mangum BD, Hardy ME, Campbell DS, Parant ...) (current)
- 02:30, 19 December 2007 (diff | hist) . . (0) . . m P5E-bactin2 (→Sequence)
- 02:30, 19 December 2007 (diff | hist) . . (+47) . . P5E-bactin2
- 03:40, 12 December 2007 (diff | hist) . . (0) . . Att site sequences (→list of att sites) (current)
- 20:21, 10 December 2007 (diff | hist) . . (+8) . . P3E-IRES-nlsEGFPpA (→Construction details)
- 20:18, 10 December 2007 (diff | hist) . . (+29) . . P3E-IRES-EGFPCAAXpA (→Construction details)
- 00:36, 10 December 2007 (diff | hist) . . (+163) . . Main Page (→Revision history)
- 00:34, 10 December 2007 (diff | hist) . . (+557) . . Att site sequences
- 00:31, 10 December 2007 (diff | hist) . . (-32) . . Att site sequences (→att site shared sequences)
- 12:11, 7 November 2007 (diff | hist) . . (+12) . . N MediaWiki:Pagetitle (New page: $1 - Tol2kit) (current)
- 04:13, 6 November 2007 (diff | hist) . . (+11) . . MediaWiki:Sidebar
- 04:13, 6 November 2007 (diff | hist) . . (-21) . . Protocols (→Assembling sequences for expression clones)
- 04:10, 6 November 2007 (diff | hist) . . (+567) . . Protocols
- 04:06, 6 November 2007 (diff | hist) . . (+60) . . Inserts and ends (→What are these sequences?) (current)
- 04:05, 6 November 2007 (diff | hist) . . (+135) . . Main Page (→Revision history)
- 04:03, 6 November 2007 (diff | hist) . . (+5) . . MediaWiki:Sidebar
- 04:03, 6 November 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 04:01, 6 November 2007 (diff | hist) . . (+52,829) . . Inserts and ends
- 03:58, 6 November 2007 (diff | hist) . . (+45) . . N File:Expression clone.png (example of expression clone sequence assembly) (current)
- 03:57, 6 November 2007 (diff | hist) . . (+480) . . Inserts and ends
- 03:53, 6 November 2007 (diff | hist) . . (+1,136) . . N Inserts and ends (New page: Below are insert sequences for all entry clones, and 5' and 3' end sequences for all destination clones. In all cases, we have included sequence up through the appropriate "att shared" seq...)
- 03:40, 6 November 2007 (diff | hist) . . (+1) . . m List of entry and destination vectors
- 03:40, 6 November 2007 (diff | hist) . . (+58) . . List of entry and destination vectors
- 03:39, 6 November 2007 (diff | hist) . . (+137) . . List of entry and destination vectors
- 02:06, 6 November 2007 (diff | hist) . . (+47) . . List of entry and destination vectors
- 23:19, 2 November 2007 (diff | hist) . . (+109) . . PME-mCherry no stop
- 23:19, 2 November 2007 (diff | hist) . . (+101) . . Main Page (→Clone distribution)
- 23:18, 2 November 2007 (diff | hist) . . (+2) . . Main Page (→'''The Tol2kit''')
- 23:17, 2 November 2007 (diff | hist) . . (+128) . . Main Page (→Revision history)
- 23:15, 2 November 2007 (diff | hist) . . (+62) . . N File:PME-mCherry no stop.png (Sequencher snapshot showing components of pME-mCherry no stop.) (current)
- 23:15, 2 November 2007 (diff | hist) . . (+9,404) . . N PME-mCherry no stop sequence (New page: <pre> >pME-mCherry-no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGC...) (current)
- 23:14, 2 November 2007 (diff | hist) . . (+492) . . N PME-mCherry no stop (New page: === Construction details === pME-mCherry no stop was made by PCR amplification of mCherry, using primers that add att sites, followed by a BP reaction. Sequencing confirms that all bases ...)
- 23:13, 2 November 2007 (diff | hist) . . (+61) . . N File:PME-EGFP no stop.png (Sequencher screenshot showing components of pME-EGFP no stop.) (current)
- 23:12, 2 November 2007 (diff | hist) . . (+9,625) . . N PME-EGFP no stop sequence (New page: <pre> >pME-EGFP_no_stop CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGA...) (current)
- 23:11, 2 November 2007 (diff | hist) . . (+623) . . N PME-EGFP no stop (New page: === Construction details === pME-EGFP no stop was made by PCR amplification of the EGFP insert from a pCS2-based plasmid, using primers that add att sites, followed by a BP reaction. Sequ...)
- 23:09, 2 November 2007 (diff | hist) . . (+6,958) . . PME-mCherryCAAX sequence H80D (current)
- 23:07, 2 November 2007 (diff | hist) . . (+719) . . PME-mCherryCAAX
- 23:03, 2 November 2007 (diff | hist) . . (+65) . . N File:PME-mCherryCAAX H80D.png (Sequencher screenshot showing components of pME-mCherryCAAX H80D.) (current)
- 23:03, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crude map) (current)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 23:00, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name) (current)
- 23:00, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence H80D (PME-mCherryCAAX sequence H80D moved to PME-mCherryCAAX H80D sequence: indicating H80D mutation in page name)
- 23:00, 2 November 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D (→Crudely annotated sequence)
- 22:59, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name)
- 22:59, 2 November 2007 (diff | hist) . . (+43) . . N PME-mCherryCAAX sequence (PME-mCherryCAAX sequence moved to PME-mCherryCAAX sequence H80D: indicating H80D mutation in page name) (current)
- 22:59, 2 November 2007 (diff | hist) . . (-14) . . PME-mCherryCAAX H80D
- 22:57, 2 November 2007 (diff | hist) . . (+820) . . List of entry and destination vectors
- 22:53, 2 November 2007 (diff | hist) . . (0) . . m PME-mCherryCAAX H80D (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 22:53, 2 November 2007 (diff | hist) . . (+34) . . N PME-mCherryCAAX (PME-mCherryCAAX moved to PME-mCherryCAAX H80D: adding page for pME-mCherryCAAX without mutation)
- 11:34, 31 October 2007 (diff | hist) . . (+51) . . MediaWiki:Sidebar
- 11:33, 31 October 2007 (diff | hist) . . (+248) . . Sources (→References) (current)
- 11:32, 31 October 2007 (diff | hist) . . (+5) . . Sources (→Transposon backbone)
- 11:24, 31 October 2007 (diff | hist) . . (+150) . . Sources
- 11:20, 31 October 2007 (diff | hist) . . (+52) . . Main Page (→Links)
- 17:14, 30 October 2007 (diff | hist) . . (0) . . Main Page (→Citing the Tol2kit)
- 17:12, 30 October 2007 (diff | hist) . . (+39) . . Main Page (→Citing the Tol2kit)
- 12:28, 12 October 2007 (diff | hist) . . (+144) . . Invitrogen manual
- 03:35, 12 October 2007 (diff | hist) . . (+4) . . m Main Page (→Revision history)
- 03:35, 12 October 2007 (diff | hist) . . (-65) . . Main Page (→About this site)
- 19:06, 11 October 2007 (diff | hist) . . (+141) . . Main Page
- 19:03, 11 October 2007 (diff | hist) . . (-85) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (-41) . . Protocols
- 19:01, 11 October 2007 (diff | hist) . . (+844) . . N Invitrogen manual (link to archived copy of Invitrogen manual)
- 18:54, 11 October 2007 (diff | hist) . . (-10) . . Protocols (→Donor Vectors)
- 18:54, 11 October 2007 (diff | hist) . . (-11) . . Protocols (→What you will need)
- 18:53, 11 October 2007 (diff | hist) . . (-10) . . Protocols
- 18:51, 11 October 2007 (diff | hist) . . (0) . . Main Page
- 02:22, 29 September 2007 (diff | hist) . . (+352) . . P5E-MCS (→Construction details)
- 02:14, 29 September 2007 (diff | hist) . . (+186) . . PME-MCS (→Construction details)
- 02:14, 28 September 2007 (diff | hist) . . (+3) . . List of entry and destination vectors
- 02:06, 28 September 2007 (diff | hist) . . (+52) . . N File:PME-MCS.png (Sequencher screenshot showing components of pME-MCS.) (current)
- 02:02, 28 September 2007 (diff | hist) . . (+7,945) . . N PME-MCS sequence (New page: <pre> >pME-MCS CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCA GTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC GCGTTGGCCGATTCATTAAT...) (current)
- 23:32, 27 September 2007 (diff | hist) . . (+167) . . PME-MCS (→Construction details)
- 23:30, 27 September 2007 (diff | hist) . . (+794) . . N PME-MCS (New page: === Construction details === pME-MCS was made by PCR of the pBSII SK+ multiple cloning site, from M13F to M13R primers, followed by a BP reaction with pDONR221. Sequencing confirms that al...)
- 03:21, 24 September 2007 (diff | hist) . . (+301) . . Main Page (→Revision history)
- 03:12, 24 September 2007 (diff | hist) . . (+573) . . Sources
- 13:51, 15 September 2007 (diff | hist) . . (+447) . . N Invitrogen ccdB (New page: ccdB sequence found in pDest R4-R3. The lowercase "c" indicates a T>C mutation relative to the ccdB sequence from Genbank. <pre> ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG...) (current)
- 13:47, 15 September 2007 (diff | hist) . . (+1,091) . . Sources
- 13:36, 15 September 2007 (diff | hist) . . (+214) . . Basic Gateway principles (current)
- 13:29, 15 September 2007 (diff | hist) . . (-17) . . Main Page (→About this site)
- 13:28, 15 September 2007 (diff | hist) . . (0) . . Main Page (→About this site)
- 13:27, 15 September 2007 (diff | hist) . . (+21) . . N Components used for the Tol2kit (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately) (current)
- 13:27, 15 September 2007 (diff | hist) . . (0) . . m Sources (Components used for the Tol2kit moved to Sources: combining with References page, renaming appropriately)
- 12:42, 14 September 2007 (diff | hist) . . (+82) . . List of entry and destination vectors
- 16:17, 12 September 2007 (diff | hist) . . (+11) . . m Main Page (→Citing the Tol2kit)
- 16:17, 12 September 2007 (diff | hist) . . (+62) . . Main Page (→Citing the Tol2kit)
- 11:58, 12 September 2007 (diff | hist) . . (-49) . . Main Page (→About this site)
- 13:17, 11 September 2007 (diff | hist) . . (+9) . . Main Page (→Citing the Tol2kit)
- 13:16, 11 September 2007 (diff | hist) . . (+35) . . Sample results with the Tol2kit (current)
- 13:08, 11 September 2007 (diff | hist) . . (-18) . . Basic Gateway principles
- 13:07, 11 September 2007 (diff | hist) . . (+1,322) . . Basic Gateway principles (→How we use this in the Tol2kit)
- 12:58, 11 September 2007 (diff | hist) . . (-46) . . Main Page (→About this site)
- 12:57, 11 September 2007 (diff | hist) . . (-2) . . Main Page (→'''The Tol2kit''')
- 20:53, 17 August 2007 (diff | hist) . . (+242) . . Main Page (→Revision history)
- 20:49, 17 August 2007 (diff | hist) . . (+46) . . MediaWiki:Sidebar
- 22:53, 25 June 2007 (diff | hist) . . (+19) . . PME-mCherryCAAX H80D (→Construction details)
- 22:52, 25 June 2007 (diff | hist) . . (+131) . . PME-mCherryCAAX H80D (→Construction details)
- 22:50, 25 June 2007 (diff | hist) . . (+5) . . PME-mCherryCAAX H80D sequence
- 03:04, 21 June 2007 (diff | hist) . . (+562) . . PDestTol2pA (→Construction details) (current)
- 20:51, 18 June 2007 (diff | hist) . . (+577) . . PME-mCherryCAAX H80D (→Construction details)
- 18:08, 7 June 2007 (diff | hist) . . (+4) . . m Main Page (→Revision history)
- 18:08, 7 June 2007 (diff | hist) . . (+77) . . m Main Page (→Revision history)
- 18:07, 7 June 2007 (diff | hist) . . (+392) . . List of entry and destination vectors
- 17:51, 7 June 2007 (diff | hist) . . (+200) . . Main Page (→Revision history)
- 17:50, 7 June 2007 (diff | hist) . . (+6) . . PDestTol2CG2 sequence (current)
- 17:49, 7 June 2007 (diff | hist) . . (+69) . . PDestTol2CG2 (→Crudely annotated sequence)
- 17:48, 7 June 2007 (diff | hist) . . (+6) . . PDestTol2pA2 sequence (current)
- 17:47, 7 June 2007 (diff | hist) . . (+69) . . PDestTol2pA2 (→Crudely annotated sequence)
- 17:44, 7 June 2007 (diff | hist) . . (+6) . . PDestTol2CG sequence (current)
- 17:43, 7 June 2007 (diff | hist) . . (+69) . . PDestTol2CG (→Crudely annotated sequence) (current)
- 17:42, 7 June 2007 (diff | hist) . . (+7) . . PDestTol2pA sequence (current)
- 17:41, 7 June 2007 (diff | hist) . . (+69) . . PDestTol2pA (→Crudely annotated sequence)
- 16:05, 5 June 2007 (diff | hist) . . (+8) . . Sample results with the Tol2kit (→Validation of IRES clones)
- 16:01, 5 June 2007 (diff | hist) . . (+95) . . N File:IRES results.jpg (Confocal images of trunk of 24 hpf embryos mosaically expressing various IRES-based constructs.) (current)
- 16:00, 5 June 2007 (diff | hist) . . (+358) . . Main Page
- 15:55, 5 June 2007 (diff | hist) . . (+1,143) . . Sample results with the Tol2kit
- 03:08, 17 May 2007 (diff | hist) . . (+325) . . Protocols
- 22:04, 13 May 2007 (diff | hist) . . (-33) . . P5E-UAS (→Construction details)
- 16:17, 11 May 2007 (diff | hist) . . (+120) . . m Protocols (→LR reactions)
- 16:05, 11 May 2007 (diff | hist) . . (+173) . . Main Page
- 12:03, 11 May 2007 (diff | hist) . . (-1) . . PDestTol2pA2 (→Construction details)
- 12:03, 11 May 2007 (diff | hist) . . (-1) . . PDestTol2CG2 (→Construction details)
- 02:02, 2 May 2007 (diff | hist) . . (-194) . . m Main Page (→Revision history)
- 02:01, 2 May 2007 (diff | hist) . . (+126) . . Main Page
- 01:46, 2 May 2007 (diff | hist) . . (-33) . . MediaWiki:Sidebar
- 01:45, 2 May 2007 (diff | hist) . . (-7) . . MediaWiki:Sidebar
- 01:45, 2 May 2007 (diff | hist) . . (-7) . . Main Page
- 01:42, 2 May 2007 (diff | hist) . . (0) . . MediaWiki:Sidebar
- 01:41, 2 May 2007 (diff | hist) . . (+1) . . MediaWiki:Sidebar
- 01:40, 2 May 2007 (diff | hist) . . (+7) . . MediaWiki:Sidebar
- 01:29, 2 May 2007 (diff | hist) . . (+32) . . MediaWiki:Sidebar
- 01:18, 2 May 2007 (diff | hist) . . (-417) . . List of entry and destination vectors
- 01:17, 2 May 2007 (diff | hist) . . (+474) . . Main Page
- 01:09, 2 May 2007 (diff | hist) . . (+1) . . m List of entry and destination vectors (→Revision history)
- 00:44, 2 May 2007 (diff | hist) . . (+62) . . MediaWiki:Sidebar
- 17:04, 30 April 2007 (diff | hist) . . (+120) . . P3E-mCherrypA (→Construction details)
- 17:03, 30 April 2007 (diff | hist) . . (+162) . . P3E-EGFPpA (→Construction details)
- 13:54, 22 April 2007 (diff | hist) . . (+43) . . MediaWiki:Sidebar
- 13:50, 22 April 2007 (diff | hist) . . (+59) . . MediaWiki:Sidebar
- 13:48, 22 April 2007 (diff | hist) . . (+163) . . Main Page (→Clone distribution)
- 21:37, 18 April 2007 (diff | hist) . . (+14) . . MediaWiki:Sidebar
- 21:36, 18 April 2007 (diff | hist) . . (+233) . . N MediaWiki:Sidebar (New page: * navigation ** mainpage|mainpage ** List of entry and destination vectors|Entry/Dest clone list ** portal-url|portal ** currentevents-url|currentevents ** recentchanges-url|recentchanges ...)
(newest | oldest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)